I need help with this vocabulary

I Need Help With This Vocabulary

Answers

Answer 1
2. Distinguish 3. Lobby 4. Indifferent
Answer 2

Answer:

2. Distinguish

3.lobby

And 4 is indifferent

:)


Related Questions

Help me please!!!

Which of the following best states the author’s point of view?
A. Watching movies encourages criminal behavior in children.

B. Violent movies may help reduce crime rates.

C. Violent children find movies to be very entertaining.

D. Crime rates in our country are decreasing.


Which sentence or phrase from the passage best supports your answer?
A. Opponents of movie violence claim that crime is on the rise.

B. According to the U.S. Bureau of Justice Statistics, crime rates have dropped steadily since 1993, when 80 of every 1,000 people reported being victims of violent crime.

C. The homicide rate declined 48% from 1993 to 2011.

D. According to Gordon Dahl and Stefano DellaVigna, research associates of the National Bureau of Economic Research, “estimates suggest that in the short-run violent movies deter almost 1,000 assaults on an average weekend.”

Answers

Answer:

C

Explanation:

i think the answer is C actually

Based on the facts presented in The Riddle of the Rosetta Stone, what is the most logical prediction that can be made about the progress made to decipher the hieroglyphs on the Rosetta Stone?

Progress continued to be made in the years that followed.
Progress was blocked in the years that followed.
The findings were dismissed and research began again.
The findings were published and the research was ended.

Answers

Answer:

progress was continued

Explanation:

got it right on #Edgenu!ty2020

Answer:

A: Progress continued to be made in the years that followed.

Explanation:

Which TWO statements suggest that Mrs. Pringle’s attempts to reach a higher social standing as shown in Fourteen are not sensible or honorable?

She considers the physical characteristics of her guests when thinking about the Tuppers.
She blames some of her problems on Elaine, whom she wants to use to gain access to Oliver Farnsworth.
She feels genuinely concerned when she hears that one family has been affected by chicken pox.
She is determined to have her husband sit at the head of the table no matter how many guests attend the party.
She is determined to make sure no one leaves the party hungry and considers not eating.

Answers

1. She blames some of her problems on Elaine, whom she wants to use to gain access to Oliver Farnsworth.

2. She is determined to have her husband sit at the head of the table no matter how many guests attend the party.

Hope this helps! ✨
B AND C are the correct answers.
Mark brainliest!

Which word is a common noun?


OPTIONS
A. Maggies Cookie Shop
B. Dr Estranda
C. London
D. cookies

Answers

Answers is D. Cookies
Answer: D. Cookies.
Explanation:
When you see “common noun” just pick the simplest one

i think the answer is d

Answers

Answer:

i would agree with you

Explanation:

if it is direct then this is the right answer

Read this excerpt from a NASA report titled “Cosmic Fountain Powered by Giant Black Hole.” Use the skills demonstrated in this lesson to define any unfamiliar words and make sure you understand the passage’s main ideas.

Cold gas falls toward the central black hole, like water entering the pump of a fountain. Some of this infalling gas . . . eventually reaches the vicinity of the black hole, where the black hole's gravity causes the gas to swirl around with ever-increasing speeds, and the gas is heated to temperatures of millions of degrees. This swirling motion also creates strong electromagnetic forces that launch high-velocity jets of particles that shoot out of the galaxy.

What is the MOST accurate summary of this excerpt?

A)Cold gas moves rapidly toward the black hole. When it is close enough to be affected by the black hole’s gravity, the gas begins to pulse faster and faster as it becomes very hot. The pulsing motion produces forces from the electric field that cause particles to bounce around the galaxy at very low speeds.

B)Cold gas moves toward the black hole. When it is close enough to be affected by the black hole’s gravity, the gas begins to swirl faster and faster as it becomes very hot. The swirling motion produces forces from the electric and magnetic fields that cause particles to shoot out of the galaxy at very high speeds.

C)Cold gas moves slowly toward the black hole. When it is close enough to be affected by the black hole’s gravity, the gas begins to flare up and becomes very cold. The flares produce forces from the magnetic field that cause particles to shoot out of the galaxy at very moderate speeds.

D)Hot gas moves toward the black hole. When it is close enough to be affected by the black hole’s gravity, the gas begins to build up and it becomes very bright. This buildup produces forces from the electric and magnetic field that cause particles to disappear into the galaxy in a matter of seconds.

Answers

Hot gas moves toward the black hole. When it is close enough to be affected by the black hole’s gravity, the gas begins to build up, and it becomes very bright is the most accurate summary of this excerpt. Hence, option D is correct.

What is black hole’s gravity?

The black hole would weigh the same as the sun. Earth and the other planets would orbit the black hole, much as they do now with the sun. The sun won't ever turn into a black hole.

Any object that approaches these infinitely dense regions of space too closely will become spaghetti-like. Large gravity wells are created by the tremendous density of space-based black holes.

Time passes more slowly as you go near to a black hole than it does when you're far away from one. According to Einstein's hypothesis, the Earth and other large bodies can cause this effect.

Thus, option D is correct.

For more information about black hole’s gravity, click here:

https://brainly.com/question/23812391

#SPJ2

Answer:

the correct answer is D

Correct answer: D

Explanation:

i took the test

Copy the following conversation into the text box. Add punctuation and capitalization so the dialogue is written correctly.

Ingrid asked how was the science fair
it was weird answered Lenny my volcano exploded and melted the table
at least it worked said Ingrid

Answers

Answer:

Ingrid asked, "How was the science fair?", "It was weird" Answered Lenny. "My volcano exploded and melted the table! At least it worked" said Ingrid.

Explanation:

Answer:

Ingrid asked, "How was the science fair?"

"It was weird," answered Lenny. "My volcano exploded and melted the table".

"At least it worked," said Ingrid.

Explanation:

name the abcs

in a onreoginalea way not the normal but in onreoginalea way

Answers

Z-Y-X-W-V-U-T-S-R-Q-P-O-N-M-L-K-J-I-H-G-F-E-D-C-B-A

Read the excerpts from Team Moon and the NASA article.

Kennedy’s decision was triggered by an intense “space race” with the old Soviet Union. The Soviets were first in space (with Sputnik); first too with a man in space.


July 1969. It's a little over eight years since the flights of Gagarin and Shepard, followed quickly by President Kennedy's challenge to put a man on the moon before the decade is out.

A reader can best combine the information in the excerpts to

A.understand that President Kennedy’s desire to put a man on the moon was inspired by a “space race” with the Soviet Union.

B.understand that President Kennedy was unwilling to spend the vast amounts of time and resources needed for space travel.

C.understand that President Kennedy was concerned about the Soviet Union’s greater achievements in space travel.

D.understand that President Kennedy wanted the United States to put a man on the moon before the year 1970.

Answers

The answer is B I just finished the test and got it correct

Answer:

The answer is be I got it correct

Hope it helps :) :) :)

Write a paragraph of three to five sentences in which you introduce a debatable claim, provide at least one reason to support the claim, and describe a counterargument.

Please help me

Answers

Dogs are better than cats. According to www.livescience.com, cat allergies are twice as common than dog allergies. This means that cats can cause a significant amount more harm than dogs. Dogs are also more friendly and can develop deeper bonds with their owners than cats can.

Counterargument: Cats are better than dogs because they are calmer and safer. Dogs can cause lots more harm to humans than cats because of their stronger bodies and large teeth.
Datable claim: a claim based on data.
Counterargument: the opposite of what you’re trying to prove/persuade

Write a rough draft and a normal story about a haunted house with Spooky,creaky,scary,creepy,cursed,dark, black,loud,crackly,tilted,lots of room
and Ghosts,zombies,vampire,bats,ghouls,moving furniture,mice,spirits,skeleton,pictures,spiders,jars of insides
plz it is due by 11am
Only a haunted house no people like Mia or something OK thx

Answers

Answer:

See explanation below, please.

Explanation:

No one should have come to the Windstrom Haunted House party that year, but you know how it is. You just loved to break the rules at any and every possible opportunity. But this night was not the night for that. In fact, it was not the night for anyone, especially you.

But you put on your costume-a witch, of course- and traveled with some friends. You'd've forgotten their names by now, wouldn't you? Still, you all went together.

When you all arrived at the haunted house, the decorations seemed to pop out of a stage-like figure. Slime oozed from cracks in the walls, and monster props like the werewolves and ghosts were glowing.

You rubbed your hands together devilishly. This was your kind of haunted house. "Hey, maybe we shouldn't go in," a friend in your group said. "We-we don't have anything to defend ourselves with, in case he shows up."

A hearty laugh emanated from your throat. "He? Who's he? Ronald Mcdonald? Being scared of clowns is so childish. Grow up, will you?"

Your friend looked at you with pale, clear eyes. "No one should laugh in the face of Ronald Mcdonald the clown. But I'm not talking about him. I'm talking about... Peter. Do you want to hear the story?"

You and everyone else in your group sighed and said, "Okay."

But, because you pulled everyone into the haunted house, you only heard the story in increments, but this is what you got from it:

A young man by the name of Rosie McSwindle lived in the town now known as Windstrom. He was quite fine and handsome, but everyone poked at him because of his name. Eventually, Rosie had had enough and went to see Yzma, the town sorcerer. He asked for a spell to change his name, but Yzma warned the man that this would change much more than that. Rosie did not care and took the potion. At first, everything seemed well. His name was now a proper man's name, and all the ladies and gents swooned over him. But soon, things started to change for the worse. He soon turned into... a woman! And now he got made fun of even more than when he was a man with a woman's name. Now, the ghost of Peter Dillums roams the Windstrom Haunted Houses, looking for those who poke fun at his misfortune.

You laughed even more than if you hadn't of heard the story in the first place. Your friend was flabbergasted at your dismissive behavior. "W-wait! Why are you laughing? You should be terrified."

"Come on!" you laughed. "Why would you believe such a children's tale? It's Halloween! We should enjoy it."

And you did. Oh, you very much did.

(Sorry I didn't include many of the elements you listed. But this is the draft of the first part of the story. You can include whatever you want. Besides, it is your story.)

 

please help, id really appreciate if someone would take their time to find the right answer for me (will give brainliest if correct)

Answers

Answer:

I think it's the third

Possibly the third, if yes pls mark Brainly

Which of the following examples is most clearly narrated in third-person omniscient point of view?


A. She went from room to room and shouted her warning at the train's passengers, all whom seemed startled.

B. He looked up from his meal and noticed that everybody had left. How did this keep happening?

C. What did she mean by that? He searched her face for answers, but her gaze was, as always. impenetrable.

D. Bert always assumed that he was an only child, but little did he know that he had a long lost sister.

Answers

Answer:

D

Explanation:

The narrator is speaking

Bert always assumed that he was an only child, but little did he know that he had a long-lost sister. of the following examples is most clearly narrated in the third-person omniscient point of view.

What is omniscient?

The quality of omniscience is having all available information. It is typically considered to be one of the essential divine qualities, along with omnipotence and perfect goodness. Many biblical verses provide God with a wealth of knowledge, which is one source for the idea that he is omniscient. F

The third-person omniscient narrative is used in the passage, "As the campers settled into their tents, Zara hoped her eyes did not betray her anxiety, while Lisa quietly wished for the night to quickly finish." The reader has access to the feelings and inner thoughts of several characters.

In the sentence, "As the campers settled into their tents, Zara hoped her eyes did not betray her worry, while Lisa quietly wished for the night to quickly finish," you are reading the third-person omniscient narration. The reader can read the thoughts and feelings of many different characters.

Therefore,  option (D) is correct.

Learn more about omniscient here:

https://brainly.com/question/14838331

#SPJ2

Essay on how to write Long Walk to Water in Auntie's perspective in Chapter 3.

Answers

Answer:

The best way to do abt this is to start wrighting abt the main idea then what's been happening to salva and the one girl i forgot her name but i just finished reading chpt. 6 so im just giving you some ideas on how to start it. (hope this helped so srry if it didn't)

Explanation:

You can use Essay Typer. Com

Article #2 in the Daily News pg. 225 from the book crossover

This poem is like an obituary for Chuck Bell. Write a free verse poem honoring Chuck Bell and his accomplishments. Include 8-10 facts about Chuck Bell. Your poem MUST RHYME! It should be 4 stanzas with 4 lines each.

Answers

News4today, give us the best point of view for the day.

Everyday we turn on the news and anticipate that you won’t be away.

Though people are who l hate chuck, you I would date.

Your opinions, those are easy to relate.

Chuck, I think me and you together, is my fate.

Answer:

eeeeeeeeeeeeeeeeeeeeee

Explanation:

" Keep your head up princess before your crown falls, Now these voices in your head will be your downfall, I know it gets so hard but you don't got far to go
Keep your head up princess it's a long road, and the path leads right to where they won't go, I know it hurts right now but I know you'll make it home
So keep your head up, so keep your head up"
Keep your head up princess- Anson Seabra
This song is beautiful! T-T

Answers

Answer:

Agreed!!!!!!!!!

Explanation:

You have good taste!

What does ceiling mean

Answers

Answer: The cover of the top of a room.

Explanation: The ceiling is an interior surface that covers and finishes the upper limits of a room. If you're inside, look up. There you go.

What best describes the mood the setting creates for the audience?
WILL GIVE BRAINLIEST
A. annoyed
B. expectant
C. overwrought
D. suspicious

Answers

Answer:

B.? is there another q to be with this?

Explanation:

Pretty sure it’s b is this the only question with this

Which answer best identifies the preposition and the object of the preposition in the sentence?

Our car bounced and rattled loudly over the old bridge.


preposition, and; object of the preposition, bounced, rattled


preposition, loudly; object of the preposition, rattled


preposition, over; object of the preposition, bridge


preposition, our; object of the preposition, car

Answers

Answer:

Explanation:Our car bounced and rattled loudly over the old bridge. ... preposition: our; object of the preposition: car D.

preposition, over; object of the preposition, bridge

PLEASE HELP I WILL GIVE BRAINLIEST

Answers

Answer:

A.

Explanation:

please help i wanna compare my answers to someone else it'll help me understand it further

Answers

Answer:

he loved you:)

Explanation:

Wait wha going on I’m lost

Identify one type of rhetorical devices used in paragraph and what sentence is it?

Ladies and gentlemen, my friends and family, I have just been handed a little note, as you probably say. It is an invitation to visit the President of the United States in his home, the White House.

Answers

Answer:

Ethos

Explanation:

The speaker is appealing to ethics, by sounding and demonstrating their ethics in this speech.

Identify one type of rhetorical devices used in paragraph and what sentence is it?

I am not a young woman now, friends. My life is behind me. There is not too much fire burning inside me. And before it goes out, I want you to use what is left to light that fire in you. So that you can carry on, and so that you can do those things that I have done. Then, when my fires have burned out, and I go where we all go someday, I can be happy.

Answers

Answer:

One rhetorical part would be, I want you to use what is left to light that fire in you.

Explanation:

Thank you Ma'am. Compare and contrast the mood of both pieces. How did you feel while you were reading? How did you feel watching the video?

Answers

Answer:

sometimes reading is boring but watching videos makes intrest in the mind which makes us more attractive to learn...

pls mark it brainliest ...plsssss

when watching the video, i was more interested than reading. i find reading boring so i don't have any interest.

Read the following excerpt from Harriet Beecher Stowe's novel Uncle Tom's Cabin, paying attention to the persuasive words Stowe uses.
And now, men and women of America, is this a thing to be trifled with, apologized for, and passed over in silence? Farmers of Massachusetts, of New Hampshire, of Vermont, of Connecticut, who read this book by the blaze of your winter-evening fire,—strong-hearted, generous sailors and ship-owners of Maine,—is this a thing for you to countenance and encourage? Brave and generous men of New York, farmers of rich and joyous Ohio, and ye of the wide prairie states,—answer, is this a thing for you to protect and countenance?
What inspiring words and phrases does Stowe use to persuade her audience that they were too ethical to continue slavery?
"trifled with," "apologized for," "passed over in silence"
"strong-hearted," "generous," "brave," "joyous"
"farmers," "sailors," "ship-owners," "ye of wide prairie states"
"countenance," "encourage," "rich," "protect"

Answers

Answer:

"strong-hearted," "generous," "brave," "joyous"

Explanation:

these were words that describe the audience as good people with ethics, and these words were used to persuade the audience into accepting that they were too ethical to continue slavery.

Answer:

"Strong-hearted," "Generous," "Brave," "Joyus"

Explanation:

which sentence correctly uses an appositive phrase?

Answers

Answer:

C. Rebecca, a talented artist, was working on a new painting.

Explanation:

An appositive phrase is a group of nouns that renames the noun next to it. In the 3rd answer, it named "Rebecca" and then "a talented artist".

c, it has two commas and a describing phrase

According to The Riddle of the Rosetta Stone, what detail helped scholars determine that the second Egyptian inscription was a simpler form of Egyptian writing that had been created by “the people”?

The scholars had seen examples of it before written on rolls of papyrus, a writing material used by the Egyptians.
Since the scholars had already studied Egyptian languages, they recognized both the hieroglyphs and the demotic version.
The Greek inscription, which had already been deciphered, explained how to translate each of the Egyptian passages.
Since only ancient Egyptians understood hieroglyphs, the scholars knew the second inscription had to be a simpler version of the first.

Answers

Answer:

The scholars had seen examples of it before written on rolls of papyrus, a writing material used by the Egyptians.

Answer:

Which had already been deciphered.

Explanation:

This is the answer because if it was already deciphered then it would be easier to understand. I think this is it i'm sorry if it isn't.

I Wandered Lonely as a Cloud by William Wordsworth
I wandered lonely as a Cloud That floats on high o'er vales and Hills, When all at once I saw a crowd, A host, of golden Daffodils; Beside the Lake, beneath the trees, Fluttering and dancing in the breeze.
Continuous as the stars that shine And twinkle on the milky way, They stretched in never-ending line Along the margin of a bay: Ten thousand saw I at a glance, Tossing their heads in sprightly dance.
The waves beside them danced; but they Out-did the sparkling waves in glee: A Poet could not but be gay In such a jocund company: I gazed—and gazed—but little thought What wealth the show to me had brought:
For oft when on my couch I lie In vacant or in pensive mood, They flash upon that inward eye Which is the bliss of solitude, And then my heart with pleasure fills, And dances with the Daffodils.
What effect does the poetic form of “I Wandered Lonely as a Cloud” have on Wordsworth’s message? Describe the poetic form Wordsworth uses in the poem and explain how it affects the meaning. Your response should be one to two paragraphs.

Answers

Answer:

Continuous as the stars that shine And twinkle on the milky way,

Explanation:

The clincher sentence:

Answers

It basically summarizes the topic or the concept of the paragraph. It states clearly what was explained in the paragraph. Usually it's at the end of a paragraph. So I think what you chose is right.. check again though

Answer:

it is D

Explanation:

Think about the arguments that Chief Joseph and the Red Coats make, including their reasons in favor of and risks associated with their argument. What does each side’s argument show you about what they believe in and value most?

Answers

Answer:

(sorry i dont have examples)

Explanation:

i think their arguments show their beliefs and values thru their word choices and the topic being argued

Other Questions
As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg If you travel 7.5 km and walk for 1.5 h, what is your average speed? Show your work? what is the role of private security within the criminal justice system How does the U.S. Constitution best reflect the ideal of separation of powers? Giving brainliest In the equation 3x+7=15, the number 7 is a. At Summer camp, campers are divided into groups. Each group has 16 campers and 2 cabins. How many cabins are needed are needed for 48 campers? A: 14 B: 20 C: 6 D: 30 What kind of heritability estimates (broad sense or narrow sense) are obtained from human twin studies?