Answer:
Translation: GAUGCUUCCAACGACCACTA
Transcription:
GTACGAAGGTTGCTGGTGAT
GATGCTTCCAACGACCACTA
Explanation:
By leaving crop roots in the ground and stalks on the surface, no-till plowing helps prevent ____________________.
*edit* i now found the answer :) and if you are wondering what it is it soil erosion
i know its says biology but its just regular science on edge 2020
Answer:
Soil erosion.
Explanation:
No-till plowing can be defined as a farming method or technique which typically involves planting crops (seedlings) without tilling the soil rather the farmer would only open a narrow or very shallow trench of sufficient depth and width to cover up the seedlings. Thus, the no-till plowing makes crop residues to be left on the soil and by extension preventing soil erosion through the absorption of water by the crop residues.
Hence, by leaving crop roots in the ground and stalks on the surface, no-till plowing helps prevent soil erosion.
Additionally, the water retention ability of no-till plowing is usually a boon to farmers because it slows down evaporation and serves as a good protection for drought-stricken environments.
Answer:
i think weeds
Explanation:
plz correct me if im wrong
is protozoans biotic or abiotic
Answer:
biotic duh!!!!!!!!!!!!!!!!!!!!!!!!!!!!
An aquifer is a non permeable layer of rock that contains or transports
The water cycle can have an influence on
Translate this rna triplet : UUU
4. The diagram below shows the procedures scientists use to clone a frog from the nucleus
of another frog's skin cell.
Skin cells in
culture dish
Nucleus in pipet
Inject nucleus
into egg
Tadpole
Young
embryo
Adult frog
Untertilized e99
mo
Destroy nucleus
by irradiation
The procedure is evidence that
A. The nucleus of a skin cell protects the frog.
B. Only skin cells can be used to clone a frog.
C. The skin cells are the reproductive cells in frogs.
D. The nuclei of the skin cells of the frog contain all the DNA needed to clone the
frog.
Answer:
D
Explanation:
the nuclei of the skin cells of the frog contain all DNA needed to clone the frog
The branch of science which deals with the study of a living being is called biology.
The correct option is D
The branch of biology which deals with living things along with technology is called biotechnology. In the question, the genes from the Skin cell of the frog are injected into the egg cell.
This experiment is done because scientist wants to inject the skin cell and pass this character to the new frog without fertilization.
Hence the correct option is D that is The nuclei of the skin cells of the frog contain all the DNA needed to clone the frog.
For more information, refer to the link:
https://brainly.com/question/25026730
Please help me figure this out I don't understand this.
Answer: The big blue ball is the NUCLEUS, The things with The Rib looking things, Are the MITOCHONDRIA, The green circles are called the APICOPLAST, The outside is called the RBC, You might have to search the rest up because i don't know the rest!
Explanation:
Please help me guys!!
What do you think would have happened to the deer on the island had wolves NOT been introduced? How do you predict this would affect the ecosystem?
If the wolves had not been introduced, the population of deers will increase which would cause the deers offspring to increase in ecosystem.
What do you mean by ecosystem?An ecosystem consists of all the organisms and the physical environment with which they interact. These biotic and abiotic components are linked together through nutrient cycles and energy flows.
An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and landscape, work together to form a bubble of life. Ecosystems contain biotic or living, parts, as well as abiotic factors.
Healthy ecosystems clean our water, purify our air, maintain our soil, regulate the climate, recycle nutrients and provide us with food. They provide raw materials and resources for medicines and other purposes.
Learn more about ecosystem:
https://brainly.com/question/13979184
#SPJ2
2. Select the systems below that are affected by cystic fibrosis:*
A. Reproductive
B. Lymphatic
C. Respiratory
D. Gastrointestinal
E. Neuro
F. Integumentary
OOOO
Answer:
ACDFHope it helps youThe systems affected by cystic fibrosis are the respiratory, gastrointestinal, reproductive, and integumentary.
Cystic fibrosis is a condition that damages organs in the gastrointestinal system or digestive system and the respiratory system. It can lead to damages in:
The lungs (respiratory system)The pancreas (gastrointestinal system)This condition is caused by the accumulation of mucus on organs due to a defective gene. This accumulation leads to negative effects in these systems but also in other systems such as:
Frequent respiratory infection (respiratory system)Damage to the airways (respiratory system)Digestive problems such as diarrhea or constipation (digestive system)Infertility (Reproductive system)Yellowing of the skin (integumentary system)Thus, the systems affected are the respiratory, gastrointestinal, reproductive, and integumentary; while others such as the lymphatic or neurological are not affected.
Learn more in: https://brainly.com/question/97940
C. Suppose you catch 100 fish out of this pond. About how many of these fish would you expect to be
tagged? Explain.
Sot the Fish to catch to 100. Click Catch and check. How does the number of tagged fish shown
Answer:
C
Explanation:
Which of the following is not a risk factor for metabolic syndrome?
A. Hyperglycemia (high blood glucose)
B. Hypertriglyceridemia (high blood triglycerides)
C. Low LDL cholesterol
D. Excess abdominal fat
Answer:
The answer is C
Explanation:
Among the following is not a risk factor for metabolic syndrome is - C. Low LDL cholesterol.
A metabolic syndrome is a group of conditions that can result in cardiovascular diseases such as heart disease, diabetes, stroke, and other health problems. Metabolic syndrome is classified only if a person has three or more of the following risk factors:
High blood glucose or hyperglycemiaIncreased levels of LDL (“bad”) cholesterol in the bloodHigh levels of triglycerides in the bloodLarge waist circumference or “apple-shaped” body due to excess abdominal fatHigh blood pressureThus, the correct answer is - C. Low LDL cholesterol
Learn more about LDL:
https://brainly.com/question/1900846
Current ethanol production as fuel does not significantly reduce greenhouse gas emissions because:____.
Answer:
Explanation:no body knows
PLEASE HELP MEEEEE (AG)
Which of the following statements is true about photosynthesis and cellular respiration?
Both photosynthesis and cellular respiration occur in all living things.
Only cellular respiration occurs in all living things.
Photosynthesis occurs in the nucleus of the cell.
Only photosynthesis occurs in all living things.
Answer:
The answer is D.
Explanation:
Photosynthesis is the process through which plants utilize water and carbon dioxide to form glucose and oxygen.
Describe: Fossil fuels are used in many ways. Using the Gizmo, describe the main use for each fuel.
Coal:
Petroleum:
Natural gas:
In each case, what is the end product of burning the fossil fuel, and where does it go?
Answer:
Coal:
Coal is primarily used as fuel to generate electric power
Petroleum:
heating and electricity generation, asphalt and road oil, and feedstocks for making the chemicals, plastics, and synthetic materials
Natural gas:
heating, cooking, and electricity generation.
it all end up in the atmosphere
Explanation:
The coal is burned and the heat given off is used to convert water into steam, which drives a turbine.
petroleum was formed from the remains of ancient marine organisms, such as plants, algae, and bacteria.
Like oil, natural gas is a product of decomposed organic matter, typically from ancient marine microorganisms, deposited over the past 550 million years. This organic material mixed with mud, silt, and sand on the sea floor, gradually becoming buried over time.
Coal and natural gas are burned in power plants to boil water. Steam from boiling water converts turbines into electricity. Carbon dioxide from burning fuel is released into the atmosphere.
This is about description of fossil fuels which are simply fuels that are formed from natural processes.
The uses and end products of fossil fuels are talked about in the explanations below;
1) (I) The primary use of the fossil fuel named coal is to generate electricity.ii) When coal is burnt, it produces a very high heat. This heat is so high that it converts water into high-pressure steam. What drives a turbine is a high pressure steam and this drive makes the turbine to produce electricity.
2) I) Petroleum products are used to set vehicles in motion, for asphalt on roads, production of electricity and heating of buildings.II) when petroleum is burnt to create energy, it produces high amount of carbon dioxide and other toxic gases into the atmosphere that can cause greenhouse effect.
3) I) Natural gas is used primarily as a source of energy for cooking, generating heat and for providing electricity.II) When it undergoes combustion is produces large amount of carbon dioxide and nitrogen oxides into the atmosphere.
Read more at; https://brainly.com/question/20014866
Please choose the correct letter option below
Use complete sentences or list form in order to describe the steps of replication. You must
use the following words and underline them:
Nucleus Helicase
Complementary strand
DNA Polymerase Ligase
Okasaki Fragments 5’ to 3’ Leading strand
Lagging strand
Answer:
Please find the description of the steps involved in DNA replication below. The terms listed in the question are written in BOLD.
Explanation:
DNA replication is the process by which DNA molecule is duplicated in the genome to produce two identical copies. DNA replication, which must occur prior to any cell division, involves the following steps:
- An enzyme called DNA HELICASE unwinds the double strand of DNA into a Y-shaped replication fork.
- Another enzyme called DNA POLYMERASE attaches to the single strand of DNA to add nucleotides to the growing DNA molecule.
- An enzyme called DNA PRIMASE adds a short nucleotide sequence called PRIMER, which serves as foundation for DNA polymerase to act upon.
- The DNA polymerase adds nucleotides based on complementary base pairing rule i.e. A-T, G-C.
Nucleus Helicase
Complementary strand
DNA Polymerase Ligase
Okasaki Fragments 5’ to 3’ Leading strand
Lagging strand
For the animal you choose, briefly describe it (physical description, habitat, etc.). Then, list all the organ systems of the animal. From this list, choose one organ system to describe in detail. Describe how the whole system works and functions. Include the function of every organ involved in that organ system.
Answer:
he Axolotl, or the Ambystoma mexicanum, is located in the class amphibia and in the family of Ambystomatidae. They are a critically endangered species that resides in Mexico. More specifically, the walking fish is native only to Lake Xochimilco and Lake Chalco in central Mexico. These unique fish have many attributes that makes it different from other amphibians and fish found in lakes.
Axolotls are 9 inch "walking fish" that have the amazing ability to regenerate limbs. They can regenerate any lost limb, including their head. This salamander has a soft bodies with small "horns" sprouting from the sides of their head. These horns are actually gills, meaning that instead of having their gills located inside of their pharynx the frills are set on the sides of their head.
The spots commonly found on an axolotl are not unusual, it's part of an extremely advanced system called the lateral line system. This system consists of electroreceptive ampullary organs and mechanoreceptive neuromasts organized into lines across the creature's body. This system is connected to the nervous system, and it allows the axolotl to sense movement and vibrations in the water.
This can get you started, I didn't want to make it too easy on you! :) It has I believe 126 words, I hope you find it useful!
And pls mark brainlest!
3. What does the Earth's magnetic field reveal about the structure of the Earth's layers?
That the outer core is solid.
That the outer core is liquid.
That the mantle is solid.
That the mantle is liquid.
Answer:
The above answer is correct. The answer is That the outer core is liquid.
The Earth's magnetic field reveals the structure of the Earth's layers and the outer core is liquid. Thus, the correct option for this question is B.
What is the principle of magnetic field reveal about the earth?The principle of earth's magnetic field states the production of attraction by the motion of molten iron in Earth's core, the magnetic field protects our planet from cosmic radiation and from the charged particles emitted by our Sun. It also provides the basis for navigation with a compass.
The magnetosphere is the region that is located above the ionosphere that is defined by the extent of Earth's magnetic field in space. The Earth is composed of layers having different chemical compositions and different physical properties.
The crust of the Earth has some permanent magnetization, and the Earth's core generates its own magnetic field, sustaining the main part of the field we measure at the surface.
Therefore, the Earth's magnetic field reveals the structure of the Earth's layers and the outer core is liquid. Thus, the correct option for this question is B.
To learn more about Earth's magnetic field, refer to the link:
https://brainly.com/question/103589
#SPJ5
What is the role of ATP in photosynthesis?
Marine science notes what is marine science
Answer:
The study of oceans and their life.
Explanation:
The study of oceans, including seawater, the ocean floor, and marine plants and animals.
A Mismatch occurs when:
A. organisms that were well adapted to one environment cannot evolve rapidly enough to adapt to new circumstances.
B. when an organism is well adapted to its environment
C. when an organism inherits a mutation that decreases its reproductive success
D. when a mutation increases the reproductive success of an organism
Answer:
A
Explanation:
A mismatch occurs when organisms that were well adapted to one environment cannot evolve rapidly enough to adapt to new changes in the environment. Hence, a trait that once confers an adaptive advantage becomes inimical due to the changes in the environment.
In order words, a mismatch occurs when a once adaptive trait becomes maladaptive or no longer confers an adaptive advantage to organisms due to a change in the environment but still persists in organisms.
For example, an organism with a body adapted to aquatic habitat suddenly finds itself in a terrestrial habitat due to climate change. The body that use to be adaptive to the environment would suddenly become maladaptive to the new environment.
The correct option is, therefore, A.
In 1998, paleoanthropologist Rick Potts published an article in The Yearbook of Physical Anthropology, a peer-reviewed journal. The article was titled “Environmental Hypotheses of Hominin Evolution.” Which statement would discredit Potts’s objectivity if it were included in the article?
Answer:
I believe the human race is capable of great things.
Explanation:
Two genes (R or r) and (D or d), each with a dominant and recessive allele, are
inherited independently of each other. Which of the following combinations
could result in gametes of a plant with an Rr Dd genotype?
A. RD and rd
B. DR, Dr, Rd, dr
C. DD, Dd, dd, RR, Rr, rr
D. Rrand Dd
Answer:
B. DR, Dr, Rd, dr
Explanation:
This question involves two genes. Alleles D and R are dominant over alleles d and r. These two genes obey the law of independent assortment as proposed by Gregor Mendel.
Based on the question, a genotype RrDd will produce the following combination of gametes following the process of meiosis:
DR, Dr, dR, dr
Complete oxidation of one acetyl CoA in Krebs cycle produces 1 ATP by substrate level phosporylation
True or false
Answer:
False
Explanation:
Two ATP molecules are required to start glycolysis (from glucose), and 4 are generated by substrate-level phosphorylation. An additional 2 NADH molecules are generated, which can be used to generate another 4–6 ATP molecules through the electron transport chain in the mitochondria.
How is tone in poetry defined?
Answer:
The poet's attitude toward the poem's speaker, reader, and subject matter, as interpreted by the reader. Often described as a “mood” that pervades the experience of reading the poem, it is created by the poem's vocabulary, metrical regularity or irregularity, syntax, use of figurative language, and rhyme.
Explanation:
The pedigree below shows two generations of individuals within a family. The pedigree shows
that a daughter has a genetic trait, even though neither of her parents nor her siblings have the
trait.
7. How can the daughter have the genetic trait if no one else in the family has it?
A. The trait is determined by a recessive allele.
B. The trait is not inherited.
C. The trait is determined by a dominant allele.
D. The trait is passed only from female to female.
Answer: B The trait is determined by a recessive allele
Increasing the intensity of a stimulus may increase which of the following?
A. Firing frequency of individual neuronsFiring frequency of individual neurons.
B. Amplitude of individual action potentials in each neuronAmplitude of individual action potentials in each neuron.
C. Duration of individual action potentials in each neuronDuration of individual action potentials in each neuron.
D. Number of activated neurons.
Answer:
A. Duration of individual action potentials in each neuron
Explanation:
how does a birds digestive system work?ФΔФ
Answer:
Birds have a two part stomach, a glandular portion known as the proventriculus and a muscular portion known as the gizzard. Hydrochloric acid, mucus and a digestive enzyme, pepsin, are secreted by specialized cells in the proventriculus and starts the process of breaking down the structure of the food material.
ATP Synthase is a channel for protons to pass from and area of High concentration to an area
of low concentration. This makes in an example of:
Active Transport
Filtration
Facilitated Diffusion
Osmosis
Exocytosis
Century
Page:
What
vestigial organs?
How do they support organic
evolution ?
Answer:
Explanation:
Structures that have lost their use through evolution are called vestigial structures. They provide evidence for evolution because they suggest that an organism changed from using the structure to not using the structure, or using it for a different purpose.