I can live for over 3000 years
I am found in the drier regions of africa
i belong to the family of Malvaceae
sometimes I am referred to as the upside down tree
I am known as the tree of life
who am I​

Answers

Answer 1
Baobab tree or Adansonia digitata tree

Related Questions

explain the biological principle behind the preservation of meat by salting​

Answers

Salt prevents the growth of microorganisms on the meat because it creates an environment of high salinity in which the microorganisms can not survive. The high concentration of salt on the meat creates a steep concentration gradient of Na+ and Cl- ions across the cellular membrane of microorganisms. In other words there is a higher concentration of salt outside of the microorganisms than in the cytoplasm. This results in water moving out of the cell as it moves down it’s concentration gradient (this is osmosis). Large amounts of water leave the cytoplasm of the microorganism, killing it.

how is homeostasis maintained in glucose regulation using an example and what culd happen if the homeostasis isnt maintained​

Answers

Answer:

Homeostasis is the maintenance of a stable internal environment within the body. In the case of glucose regulation, the body works to maintain a stable blood glucose level by releasing hormones such as insulin and glucagon. If homeostasis is not maintained in glucose regulation, it can lead to conditions such as hyperglycemia (high blood glucose levels) or hypoglycemia (low blood glucose levels). Both of these conditions can be serious and potentially life-threatening if left untreated. Hyperglycemia can lead to diabetes and other long-term health problems, while hypoglycemia can cause symptoms such as dizziness, weakness, and fainting.

Answer:

Through its various hormones, particularly glucagon and insulin, the pancreas maintains blood glucose levels within a very narrow range of 4–6 mM. This preservation is accomplished by the opposing and balanced actions of glucagon and insulin, referred to as glucose homeostasis

HELP!!!!! How do musical embellishments help enhance a piece of music?

Answers

One of the few things that everyone can enjoy and relate to is music. We are all made of music.

What is Musical Embellishments?

It is an essential component of who we are. Since the very beginning of human history, music has existed in all civilizations and all countries. Music, according to Henry Wadsworth Longfellow, is the human race's global language.

Amazingly, music can unite disparate groups of individuals. We can learn how to relate to others and develop our empathy through music. Peace can be attained through music. Fear, separation, and misunderstanding obstacles can be destroyed with just one person's understanding.

In Northern Europe at the end of December 1914, during World War I, music effectively facilitated peace.

Therefore, One of the few things that everyone can enjoy and relate to is music. We are all made of music.

To learn more about Music, refer to the link:

https://brainly.com/question/29521345

#SPJ1

How do you calculate pedigree risk?

Answers

Pedigree risk calculation: A heterozygote has a 50% chance of not passing the a gene to their progeny. The likelihood that she won't pass it on to one of her two children is (1/2)(1/2) = 0.5 2 = 1/4.

By analysing a pedigree, we may identify genotypes, recognise phenotypes, and predict how a trait will be passed down in the future. A pedigree's information can be used to assess an allele's mode of inheritance, such as whether it is dominant, recessive, autosomal, or sex-linked.

Analyze the trait's dominance or recessivity. The trait must be possessed by one of the parents in order to be dominant. No generation will be exempt from prevailing traits. As long as both parents are heterozygous, a recessive characteristic can exist even if neither parent possesses it.

If the trait is autosomal or sex-linked, analyse the graph to find out (often X-linked). For instance, in X-linked recessive traits, males are noticeably more likely to be affected than females. Autosomal traits have an equal chance of affecting males and girls (usually in equal proportions).

Learn more about X-linked recessive traits from:

https://brainly.com/question/3179375

#SPJ4

What is the function of the interdigital membranes in frogs? Do all frogs posses them? Explain.​

Answers

Answer:

Function: To improve the animals´ movement and displacement on water.Not all frogs have well-developed membranes. Those with terrestrial habits exhibit reduced interdigital tissue.

Explanation:

The interdigital membrane is the skin between the fingers and toes of the animals. This tissue is resistant and flexible. Its expansion varies among species and depends on their habits. The principal function of these membranes is to improve the animals´ movement and displacement on water. This tissue represents a broader area that provides resistance to water so the animal can swim faster and longer. On the ground, these membranes also can be useful while jumping, but this is not its principal function. The development of the interdigital membrane show variation among amphibians. In those taxa that spend most of their time in the water, the membranes are extensive and well-developed. On the contrary, groups that spend most of their lives on the ground, on trees, and other vegetation, exhibit poorly-developed membranes or almost absent.

Length of DNA and RNA

Answers

Answer:

. A DNA molecule in a human chromosome can be up to 250 million nucleotide-pairs long; in contrast, most RNAs are no more than a few thousand nucleotides long, and many are considerably shorter.

what enzyme can proof-read the dna molecule, minimizing the mistakes made during the process of dna replication?

Answers

The DNA polymerase enzyme's capacity to proofread the DNA molecule helps to decrease DNA replication mistakes.

Fortunately, cells have developed extremely complex mechanisms to correct most of those errors, but not all of them. While some errors are fixed following replication in a stage called mismatch repair, others are fixed while replication is still happening in a stage called proofreading. Replication is impeded when an erroneous nucleotide is added to the developing strand because the exposed 3′-OH group is in the wrong location. DNA polymerase enzymes notice this during proofreading and swap out the erroneous nucleotide to keep replication going. Even if 99 percent of mistakes may be corrected by proofreading, accurate cell reproduction is still not possible.

Learn more about DNA polymerase at

https://brainly.com/question/30196920?referrer=searchResults

#SPJ4

If the results from a scientific experiment do not support the hypothesis, then the experiment
A
is a failure.
B.
can be revised.
C.
must be done again.
D
should be continued without the hypothesis.

Answers

Answer:

D

Explanation:

I need help with this. URGENT!!

Answers

The nitrogen cycle is a repeating cycle of processes during which nitrogen moves through both living and non-living things: the atmosphere, soil, water, plants, animals and bacteria.

What are the characteristics of nitrogen cycle?

The nitrogen cycle is the biogeochemical cycle by which nitrogen is converted into multiple chemical forms as it circulates among atmospheric, terrestrial, and marine ecosystems.

There are five stages in the nitrogen cycle, and we will now discuss each of them in turn: fixation or volatilization, mineralization, nitrification, immobilization, and denitrification.

The nitrogen cycle matters because nitrogen is an essential nutrient for sustaining life on Earth. Nitrogen is a core component of amino acids, which are the building blocks of proteins, and of nucleic acids.

Learn more about nitrogen cycle:

https://brainly.com/question/1615727

#SPJ1


a) In which diagram (1 or 2) would the person be experiencing summer? Why?
b) In which diagram (1 or 2) would the person he be experiencing Winter? Why?

Answers

In diagram 1, the person would experience summer whereas, in diagram 2, the person would experience winter.

How earth's axis is responsible for different seasons?

The axis of planet earth is tilted at an angle of 23.5 degrees away from the vertical plane. During the rotation around its own axis, planet earth performs a wobbly movement in which its northern hemisphere comes closer to the sun while its southern hemisphere gets away from the sun and vice versa.

In months around June, the northern hemisphere is tilted toward the sun causing it to receive more direct sunlight compared to the southern hemisphere. This creates the summer season in the northern part. The southern hemisphere meanwhile experiences winter seasons.

In months around December, the northern hemisphere is tilted away from the sun while the southern hemisphere is tilted towards the sun. Hence, the north experiences winter while the south experiences summer season.

To learn more about summer click here:

brainly.com/question/15615726

#SPJ1

Which biomolecule contains fats, oils, and waxes?

Answers

Answer:

lipids

Explanation:

have a good day! :)

The answer is lipids.

need help asap
question 3
- 20 points

Answers

The amount of population change due to immigration or emigration

According to Porter's model, which of the following should be considered when analyzing a firm's competition? (check all that apply)
buyers
the regulations in possible host countries
suppliers
the threat of substitutes

Answers

This model states that five forces determine the level of industry’s competition and profitability. The five forces are: (1) threat of new entrants, (2) bargaining power of buyers, (3) bargaining power of suppliers, (4) threat of substitutes, and (5) rivalry among existing firms.

Porter’s model of competition is a widely accepted framework for understanding the competitive landscape of an industry. When analyzing a firm’s competition, all of these forces should be considered. For example, understanding the threat of new entrants is important because it can impact the level of competition and pricing within the industry.

Similarly, the bargaining power of buyers and suppliers can be influential in setting industry prices and margins. Additionally, the threat of substitutes should be considered, as this can affect the demand for the firm’s product or service. Finally, the regulations in possible host countries should be taken into consideration, as these can also impact the firm’s ability to enter and operate in foreign markets.

Learn more about Porter’s model at :https://brainly.com/question/28074535

#SPJ4

The relative movements of Earth, the Moon, and the Sun create patterns of change we observe.
A complete and accurate model for explaining the phases of the Moon visible on Earth requires which of the following?
Select all that are needed.
- sun
-earth
- moon

Answers

The Sun constantly illuminates one-half of the Moon, but the amount of this half that we can view from Earth determines the phase that we observe. the phases of the Moon visible on Earth requires the sun, earth, and moon.

What are the phases of the Moon?

Only the "night" side of the Moon is visible during the new moon. if there is a full moon, the Moon will rise just before dusk.

About two weeks pass between the new moon and the full moon. At the new moon, the luminous portion of the Moon that faces the Sun is complete.  

Therefore, the many moon forms that are visible from Earth are referred to as phases of the moon.  

Learn more about Moon, here:

https://brainly.com/question/3287763

#SPJ1

How do you find the effort force of a second class lever?

Answers

In a class two lever the force of the effort multiplied by the distance of the effort from the fulcrum is opposite and equal to the force of the resistance multiplied by the distance of the resistance from the fulcrum.

The force utilized to move an object across a distance is called an effort force. To use a rudimentary machine to perform work on an item, this force must be overcome. By dividing the load by the number of ropes, we may get the pulley's effort force. F is the effort force in the diagram.

For instance, when using a shovel, you hold one end stable to serve as the fulcrum and pull up on a load of soil with your other hand. The resistance force is the dirt being picked up, and the effort force is the second hand.

Learn more about effort force to visit this link

https://brainly.com/question/27700154

#SPJ4

Can someone give me a brief history of yellow fever?

Answers

Answer:

Yellow fever virus originated in Africa and was brought to the western hemisphere during the slave trade era, with the first epidemic reported in 1648 in the Yucatan. Over the ensuing 200 years, outbreaks occurred widely in tropical America, the North American coastal cities, and Europe.

Explanation:

Please help me with this!!

Answers

Genetic makeup is the combination of genes that make up an individual's unique genetic code.

1.The physical appearance of an individual's genetic makeup phenotype.

2. A particular characteristic of an individual trait.

3. The passage of genetic instructions from one generation to the next generation genotype.

4. One variation of a particular gene allele.

5. The specific genetic makeup of an individual chromosomes.

6. Contain the genes of an individual heritability.

What are Chromosomes?

Chromosomes are thread-like structures composed of DNA and proteins that carry genetic information. In most living organisms, each cell contains a pair of chromosomes, one inherited from each parent. Humans have 23 pairs of chromosomes in each cell, for a total of 46. Chromosomes are responsible for determining an organism's traits, from eye color to blood type.

To know more about Chromosomes,

https://brainly.com/question/11912112

#SPJ1

Question 22 of 22 Several members of the family in the pedigree who suffered from a disease are colored in black. Currently deceased members of the family are struck out with a line. Based on the data in the pedigree, propose a Mendelian model that would explain the inheritance of this disease. Explain how the data is consistent with your model. A scientist hypothesizes that a mutation at a single locus is responsible for the pattern of inheritance seen in this pedigree. Explain how a mutation in a gene can arise during meiosis. Describe one strategy organisms use to prevent such mutations from arising.

Answers

A. Many families have Alzheimer's disease. From this we conclude that the disease is X-linked recessive.

B. Meiosis is the process of generating gamete cells. There are two choices: mutual break join and another non-reciprocal break copy.

Many families are affected by Alzheimer's disease. It cannot be autosomal inherited because it affects more men than women. Affected males in the second generation have many affected children with normal wives.

If it was autosomal dominant, the sick father would have passed it on to all his second-generation children, but that is not the case. Therefore, it cannot be autosomal dominant.

If it had been autosomal recessive, he would not have affected his children, as his wife appears normal. increase. Therefore, it is not an autosomal abnormality.

Not X-linked dominant, in which case the affected father passed his only X chromosome to his daughter, making her daughter sick. But in this case, the sons are involved. Therefore, it is not X-linked dominant.

From this we conclude that the disease is X-linked recessive.

B. Meiosis is the process of generating gamete cells. Mutations can occur during meiosis in various ways such as double-strand breaks, inversions and point mutations. Important mutation types include missense, nonsense, and point mutations. Cells use multiple repair mechanisms to repair DNA damage or mutations during meiosis. One of the most efficient mechanisms is double-strand break repair by homologous recombination (HR).

Here, the DNA is unwound at the mutated region by recA loading. Recombination with homologous pairs continues through the RecBCD complex.

Here are his two alternatives: reciprocal break join and another non-reciprocal break copy.

Repair normally occurs during her S phase of the cell cycle, when the cell divides its DNA. However, mutations that occur during meiosis, such as chromatid pairing and recombination, are not easily repaired. Cells stop dividing only when the mutation gets worse.

For more information on Alzheimer's disease , visit :

https://brainly.com/question/29972488

#SPJ4

acid rain contributes to all of the following problems except: A) smog B) loss of biodiversity C) damage to vegetation D) advance chemical weathering

Answers

Answer:

From what I've seen in my lessons the answer should be C. Just let me know if I'm wrong or not. Cheers!

This website is so bad like i asked help for something yesterday legit, and i got warned just take my points guys. es

Answers

Answer:

The number of moles of acid that were neutralized can be found by multiplying the volume of the base (in liters) by its concentration (in moles/liter) and then multiplying that value by the stoichiometric coefficient of the acid in the balanced chemical equation for the neutralization reaction.

Explanation:

To begin, we need to convert the volume of the base from milliliters to liters.

50.40 mL = 0.0504 L

Next, we can multiply the volume of the base (in liters) by its concentration (in moles/liter) to find the number of moles of base used in the titration.

0.0504 L * 0.542 M = 0.0272 moles

Since this is a neutralization reaction between a monoprotic acid and a strong base, the acid:base ratio is 1:1.

So the acid that has been neutralized is also 0.0272 moles.

Answer: Why

Explanation: That isn't good. I hope you have a good rest of your day!

Which type of granular leukocyte can engulf up to two dozen bacteria and also produces a respiratory burst that creates harsh chemical agents such as hydrogen peroxide

Answers

The type of granular leukocyte that can engulf up to two dozen bacteria and also produces a respiratory burst that creates harsh chemical agents such as hydrogen peroxide is Neutrophil.

Neutrophil:

A type of white blood cell that is an important part of the immune system and helps the body fight infection. Neutrophils are one of the first immune cells to respond when microorganisms such as bacteria and viruses enter the body. The most common type of white blood cell. Neutrophils make up 50% to 75% of all circulating leukocytes in the blood. Neutrophils, along with eosinophils and basophils, form a group of white blood cells known as granulocytes.

High neutrophil counts can be caused by many physiological conditions and diseases. This high neutrophil count is called neutrophilia.

learn more about Neutrophil:

https://brainly.com/question/27960149

#SPJ4

What changes the carrying capacity of an ecosystem?

Answers

Answer:

Several factors affect the carrying capacity of an ecosystem. These factors include food supply, water supply, habitat space, competition (intraspecific and interspecific), physical factors (e.g. extreme heat, drought, etc.), chemical factors (e.g. pH, mineral deficiency, etc.), and anthropogenic factors

Explanation:

1. Which organisms are primary producers in this food web? How do you know?

2. Which organisms are primary consumers in this food web? How do you know?

3. Which organisms are apex predators in this food web? How do you know?

4. Are there any omnivores in this food web? How do you know?

Answers

Answer:

corals is the primary producers.planktonshark

The term that refers to the presence of a tuft of flagella emerging from a single site is ______.
A. amphitrichous
B. lophotrichous
C. peritrichous
D. atrichous
E. monotrichous

Answers

Vlophotrichous Cell Biology describes tufts of flagella that are located near the cell pole.

How do flagella work? What are they made of?

Flagella are tiny organelles that resemble hairs and aid in cell movement. In Latin, "flagellum" means "whip." A cell is helped to move through the fluid by the flagella, that resemble whips. Only a few number of organisms have special flagella that serve as sensing organs for temperature and pH changes.

What is a flagella cell?

The flagellum's main purpose is to promote chemotaxis and movement. Bacteria can have one or more flagellums, and they can also be peritrichous or bipolar (containing several flagella at a single site) (having multiple flagella throughout the entire bacterium).

To know more about flagella visit:

brainly.com/question/905839

#SPJ4

What methods do cells use to increase the surface area to volume ratio?

Answers

Prokaryotic cells have inner folds of the cell membrane that are responsible for specific functions such as respiration. These creases increase the surface area.

As the cell radius increases, the surface area increases as the radius squared, but the volume increases as the radius cubed (much faster).

As the cell advance, its internal volume increases and the cell membrane expands. Unfortunately, volume increases faster than surface area, so the relative amount of surface area available to direct material to a unit volume of cells steadily decreases. The important point is that the surface area-to-volume ratio decreases as the cells get larger.

For more information on cells , visit :

https://brainly.com/question/27827698

#SPJ4

The air and nutrients that are added to the fermenter are sterile. State why they must be sterile.​

Answers

The air and nutrients that are added to the fermenter must be sterile in order to prevent contamination from pathogens or other microorganisms that could disrupt the fermentation process.

What is fermentation?

Fermentation is a metabolic process during which organic molecules such as glucose are converted into energy-containing molecules such as ethanol, carbon dioxide, and/or organic acids. This process is often used in the production of beer, wine, and other alcoholic beverages, as well as in food production, such as the production of yogurt, cheese, and other fermented dairy products.

Contamination can lead to off-flavors, off-odors, and other undesirable qualities in the end product. Additionally, it may cause the fermentation process to be less efficient, leading to longer fermentation times or even a complete failure.

To know more about fermentation,

https://brainly.com/question/11554005

#SPJ1

name 3 types of population distribution describe them?

Answers

Answer:

Individuals may be distributed in a uniform, random, or clumped pattern. Uniform means that the population is evenly spaced, random indicates random spacing, and clumped means that the population is distributed in clusters.

Explanation:

Answer:

Uniform: Evenly spaced out

Random: Random, Random Spacing

Clumped: In clutters

Explanation:

Need help ASAP! Will give brainliest;) NO LINKS please, WILL REPORT.


A). Tuna

B). Dog

C). Mold

D). Horse

Answers

Answer:

d horse ,................................ I think

Each gene ___ for a different_____

Answers

Answer:

I think its each gene pair for a different sex cell

Explanation:

i'm not 100% on this, if its wrong im very sorry

What tropism does the experimental data above show?


phototropism
hydrotropism
geotropism

Answers

Answer:

phototropism

Explanation:

This shows phototropism since plant is growing towards light.

Other Questions
To pay for a $15,900 car, Donna made a down payment of $4800 and took out a loan for the rest. On the loan, she paid monthly payments of $245.70 for 4years.(a) What was the total amount Donna ended up paying for the car (includingthe down payment and monthly payments)?(b) How much interest did Donna pay on the loan? Is this correct? I can't figure out if this is, So please answer. streamlined transportation vehicle with 2 openings and glass windows. It appears to run on some kind of track.Predict what the text will be about based on this image?a.future transportationc.both of theseb.public transportationd.neither of these Sam has always been able to pick up new languages easily. What quality does she have that helps her do this?soft skills.self-awarenesscompetencyability What baseball stat does Lawrence Hinman suggest is the most important stat for determining the best player in the game in a given year Where should the comma go in the following sentence **You should not need to round on this problem, no %'s decimals only**At Houston Community College 60% of the students who take English will pass. Of those who pass English, 70% will also pass Accounting. Of those that do not pass English, 45% will still pass accounting. How do you find the 3rd side of a triangle? Select the correct answer. Which graph represents the solutions to this equation? x2 + 8x = -20 A. Linear-quadratic system graph shows upward parabola with vertex at (minus 2, 4) and passing through x and y-axis (minus 8, 0), and (0, 0) B. Linear-quadratic system graph shows upward parabola with vertex at (minus 4, 4) and passing through (minus 2, 8), and (minus 6, 8) C. Linear-quadratic system graph shows upward parabola with vertex at (4, 0) and passing through (1, 4), and (6, 4) D. Linear-quadratic system graph shows a downward parabola with vertex at (0, 8) which intercepts the x-axis at 3 and minus 3 units. Lila swam 50 meters north in 10 seconds. Find Lila's velocity TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets. True/False: Money is more important than finding something you're going to lovedoing. Select the correct answer.Which of these is an example of elemental carbon?A. DiamondB. MethaneC. Proteins 6 less than 3 times a number 42 what is the number Two numbers total 31 and have a difference of 9. Find the two numbers. Can someone help me with this question? Can someone please help me with math. The process by which keys are managed by a third party, such as a trusted CA, is known as?O Key escrowO Key destructionO Key renewalO Key management Which sentence best states the central idea of the account?A After the Civil War, the city of San Antonio prospered.B San Antonio is famous because of the Alamo.C Market Square is a large Mexican marketplace in San Antonio.D San Antonio is a thriving city with a fascinating history. Name the minor arcs in the circle Select all the minor arcs by their correct names.