how does the phospholipid bilayer form

Answers

Answer 1

Answer:

Being cylindrical, phospholipid molecules spontaneously form bilayers in aqueous environments. In this energetically most-favorable arrangement, the hydrophilic heads face the water at each surface of the bilayer, and the hydrophobic tails are shielded from the water in the interior.

Explanation:

please mark me as the brainliest

have a fantastic day ahead


Related Questions

Explain the importance of decomposers to a food web and their interaction with quaternary consumers.

Answers

Answer:

Decomposers recycle the nutrients in dead organisms allowing it to completely travel through the food web cycle, from producer, to consumer and back again

Explanation:

This recycling also applies to quaternary consumers, the predators that generally have no natural enemies, allowing the nutrients in their bodies to be recycled.

Answer:

Decomposers recycle the nutrients in dead organisms allowing it to completely travel through the food web cycle, from producer, to consumer and back again

Explanation:

Where must an mRNA attach before protein production can begin?

Answers

Answer:

to a Ribosome

Explanation:

mRNA is produced inside the nucleus of a cell according to the genetic information present in the DNA of the cell. this process is known as Transcription.

Then it's sent to ribosomal subunits in the cytosol through nucleopores. then it attaches to the ribosome. the ribosome reads the nitrogenous base sequence and pairs the tRNAs with complementary nitrogenous bases. (your answer is here, but if you want to know more, continue reading it.)

Each tRNA contains a tri-nucleotide that is collectively known as an anticodon which has the complementary bases of the relevant codon on the mRNA.

Each tRNA has captured a protein. the type of protein is determined by the sequence of the anticodon.

It means two tRNAs with two different anticodons cannot bring the same protein to the ribosome.

the Ribosome separates the proteins attached to tRNAs and links them as a chain.

the final result is a polypeptide chain. I explained to you the basic protein synthetic process.

image credit: Wikipedia

the two proteins directly involved in muscle contraction are broadly called

Answers

The two proteins directly involved in muscle contraction are MYOSIN AND ACTIN. The interaction between these proteins is responsible for muscle contraction.

The sarcomere is the basic unit of muscle cells (myofibrils) that mediate muscle contraction both in skeletal and cardiac muscle tissue.

During muscle contraction, myosin and actin proteins slide past each other, thereby leading to sarcomere shortening.

The myosin protein binds to actin filaments and thus myosin acts as a motor protein that drives filament sliding.

Learn more in:

https://brainly.com/question/262544?referrer=searchResults

Чи може містити рослинна клітина елемент або речовину, яких немає в
навколишньому середовищі? наведіть приклади

Answers

Answer:

the first great German expressionist film was

Which organisms live in the neritic zone?
A. anglerfish
B. chemosynthetic bacteria
C. phytoplankton
D. all of the above

Answers

I’m sure that phytoplankton live in the neritic zone but the "all of the above" choice made me overthink. I’d choose between answers choices B or C.
Hopefully this helped a little :(

what happens in a symbiotic relationship that is defined as mutualistic

Answers

In a mutualistic relationship both organisms depend on eachother or may benefit from the other. Such as clown fish gaining shelter from sea anemones and the anemone gets nutrients from clownfish waste

Answer:

Mutualism describes a type of mutually beneficial relationship between organisms of different species. It is a symbiotic relationship in which two different species interact with and in some cases, totally rely on one another for survival.

Explanation:

in humans, how many chromosomes are in each cell at the end of meiosis i? how many cells are produced?

Answers

Answer:

23 chromosomes and 4 cells

Explanation:

Give advantages of endothermic animals

Answers

Answer:

The advantages of endothermy are well known: the ability to occupy thermal niches that exclude many ectothermic vertebrates, a high degree of thermal independence from environmental temperature, high muscular power output and sustained levels of activity, to name but a few.

The major advantage of endothermy over ectothermy is decreased vulnerability to fluctuations in external temperature. Regardless of location (and hence external temperature), endothermy maintains a constant core temperature for optimum enzyme activity.

Pack ice forms when frozen
seawater
a) rises from the deep zone to the surface zone.
b) sinks from the surface zone to the deep zone
c) moves onto the land.
d) is driven together by wind and waves.

Answers

Answer:

water in or taken from the sea.

Explanation:

water in or taken from the sea. AKA C.

Wetlands provide all of the following benefits except

Answers

Answer:

Wetlands provide many societal benefits: food and habitat for fish and wildlife, including threatened and endangered species; water quality improvement; flood storage; shoreline erosion control; economically beneficial natural products for human use; and opportunities for recreation, education, and research.

a hive is an example of what type of skin eruption?

Answers

Answer:

Wheal

Explanation:

Answer:

you answer is Wheals skin

Interphase or Mitosis: Protein production is high
1. Mitosis
2. Interphase

Answers

Answer:

i think in interphase

Explanation:

Hope it helps u.

what is the identity of the planets ?
a:
b:
c:
d:

Answers

Answer:

A - Jupiter

B - Neptune

C - Saturn

D - Uranus

hope that hepled :DD

what do Physical scientist explore?

Answers

Answer:

A physical scientist works mainly in a laboratory (although fieldwork may be possible), conducts experiments or makes observations, analyzes findings, operates necessary equipment, and develops and tests theories.

Explanation:

Hope This Helps!

Answer:

They explore physical things like venturing out in nature to see the size, shape, and where it goes in the ecosystem.

Explanation:

most of the iron that is removed from degraded hemoglobin is:

Answers

Answer:

Most of the iron that is removed from degraded hemoglobin is: recycled to the red bone marrow.

Most of the iron removed from degraded hemoglobin is recycled in the red bone marrow.

What is Hemoglobin?

Hemoglobin is defined as an iron-containing oxygen-transporting metalloprotein present in the red blood cells of nearly all vertebrates as well as the tissues of some invertebrates that carries oxygen from the respiratory organs in the blood to the rest of the body.

The blood protein hemoglobin that helps carry oxygen throughout the body and carbon dioxide to your lungs. High hemoglobin levels can cause dizziness, fatigue, easy bruising, and other symptoms.

The iron which is present in hemoglobin which is removed is recycled from the red bone marrow.

Thus, most of the iron removed from degraded hemoglobin is recycled in the red bone marrow.

Learn more about Hemoglobin, here:

https://brainly.com/question/15011428

#SPJ6

what anaerobic pathway in cellular respiration generates atp from the breakdown of glucose?

Answers

Glycolysis. Glycolysis is an an anaerobic reaction that does not require oxygen to breakdown glucose into 2 molecules of pyruvate and 2 net ATP.

P.S. This process is a catabolic reaction.


In glycolysis ____
is oxidized, and ____ is reduced.
A) Nad+....glucose
B) glucose.....Nad+
C) ATP.......ADP

Answers

Your answer is C. Glucose, NAD+

clusters of chlorophyll and accessory pigments are called ________.

Answers

It is photo systems.

true or false? to make a person breathe in, the volume of the chest cavity must decrease, creating a higher pressure in the thorax

Answers

The thorax is a very vital and important organ in the human body.

It is a structure that serves as a protective covering for organs in the body such as the lungs, the heart, some vital blood vessels e.t.c

It is false that to make a person breathe in, the volume of the chest cavity must decrease, creating a higher pressure in the thorax.

When a person breathes in,  the chest cavity expands (the volume increases) and the pressure in the thorax decreases.

When a person breathes out, the chest cavity decreases in size, and the pressure in the thorax increases.

Therefore, we can see that the process of breathing in humans, follows the principle of Boyle's Law.

Boyle's law states that as the volume increases there is a decrease in pressure and as the volume decrease there is an increase in pressure.

Therefore, It is false that to make a person breathe in, the volume of the chest cavity must decrease, creating a higher pressure in the thorax.

To learn more, visit the link below:

https://brainly.com/question/24359876

what is the order of the distances of the terrestrial planets from the sun, from farthest to closest?

Answers

Answer:

The order of planets from closest to farthest from the Sun are Mercury, Venus, Earth, Mars, Jupiter, Saturn, Uranus and Neptune.

What percentage of the entire reef did the scientist sample

Answers

Answer:

As a result, over 50 percent of the world's coral reefs have died in the last 30 years and up to 90 percent may die within the next century—very few pristine coral reefs still exist.

Explanation:

As a result, over 50 percent of the world's coral reefs have died in the last 30 years and up to 90 percent may die within the next century—very few pristine coral reefs still exist.

What are coral reefs?

A coral reef is an underwater ecosystem characterized by reef-building corals. Reefs are formed of colonies of coral polyps held together by calcium carbonate. Most coral reefs are built from stony corals, whose polyps cluster in groups.

Coral reefs are massive structures made of limestone deposited by coral polyps. Often referred to as the “rainforests of the sea,” coral reefs support approximately 25 percent of all known marine species.

Coral reefs protect coastlines from storms and erosion, provide jobs for local communities, and offer opportunities for recreation. They are also are a source of food and new medicines. Over half a billion people depend on reefs for food, income, and protection.

Learn more about coral reefs:

https://brainly.com/question/21965144

#SPJ2

Which of the following is not evidence for Continental Drift Theory?

Answers

main issue with Wegener's Continental Drift Theory is he did not have a mechanism behind the drifting of continents

what is the function of cartilage located in the epiphyseal plates

Answers

Answer:

Explanation:

Epiphyseal cartilage is hyaline cartilage tissue with a gelatinous texture, and it is responsible for the longitudinal growth of the long bones in birds and mammals. It is located between the epiphysis and the diaphysis. Epiphyseal cartilage also is called a growth plate or physis

What are proteins composed of, and what are their main functions in the body

Answers

Answer:

Proteins are large, complex molecules that play many critical roles in the body. They do most of the work in cells and are required for the structure, function, and regulation of the body’s tissues and organs.

Proteins are made up of hundreds or thousands of smaller units called amino acids, which are attached to one another in long chains.

Explanation:

How do cells work together to keep your windpipe clear?


Why does your body need more than one kind of cell?

Answers

each cell has a different job to do in the body

explain the roles of mRNA and tRNA in protein synthesis​

Answers

Answer:

Messenger RNA (mRNA) molecules carry the coding sequences for protein synthesis and are called transcripts; ribosomal RNA (rRNA) molecules form the core of a cell's ribosomes (the structures in which protein synthesis takes place); and transfer RNA (tRNA) molecules carry amino acids to the ribosomes during protein synthesis

Answer:

Messenger RNA (mRNA) molecules carry the coding sequences for protein synthesis and are called transcripts; ribosomal RNA (rRNA) molecules form the core of a cell's ribosomes (the structures in which protein synthesis takes place); and transfer RNA (tRNA) molecules carry amino acids to the ribosomes during protein synthesis

Explanation:

HELP!!!
how does earths axis affect our seasons

Answers

When the axis is towards the sun it is summer for that hemisphere and when it pointed away it is winter. The axis tilts affect our seasons due to it either being point towards, away from it or in the middle.
Throughout the year, different parts of earth receive the suns most direct rays. The earths tilting is what gives us 4 seasons by how tilted we are to the sun.

Match the function to the molecule.
Functions:
Provides immediate energy
Forms the cell membrane of all cells
Speeds up the chemical reactions by lowering the activation energy
Provides long-term energy
Stores genetic information
A sugar

Molecules:
Lipids
Nucleic acids
Phospholipids
Proteins
Glucose
Carbohydrates

Answers

Provides immediate energy ---> carbohydratesForms the cell membrane of all cells--->phospholipids Provides long-term energy--->lipids Stores genetic information---->nucleic acid A sugar ---->glucoseSpeeds up the chemical reactions by lowering the activation energy--->proteins(enzymes)

The water cycle plays an important role in an environment because

Answers

Answer:

it gives us water and it helps all our thing in the envierment grow and help us live.

what is the function of the mouth in the digestive system

Answers

the mouth is the beginning of the digestion tract , our mouth also produces enzymes to begin the process of digestion
Other Questions
b+2.01=5.5what does B stand for which statement best describes an example of selective breeding? I lift a 20kg ball up 2.5 meters off the ground on Earth.-Earths gravitational acceleration is about 9.8 m/s2.How much gravitational potential energy does the ball have at this point? _____________How much work did I do lifting up the ball? _____________________________________If I lift the same ball the same distance on the Moon, then how much gravitational potential energy will it have? (Moons Gravity = 1.6 m/s2) ____________________________________ Which signposts uses words that have a strong connotation?-Contrast and contradictions-Extreme or absolute language -Numbers and stats Based on the maps, what region did more railroads tracks develop - the North or South? Why do you think so? Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please