how does Genetic diversity happen

Answers

Answer 1

Answer:

Genetic diversity occurs when mutations create new alleles over time.

Explanation:

Answer 2

Answer:

Genetic diversity happens when mutations create new alleles over a period of time.

What is genetic diversity?

Genetic diversity in a very simple term is the natural variation that exists within the individuals of an species.

The first rule of Darwin's theory says, there is a natural variation. Leaving apart identical twin cases, no 2 individuals of the population are exactly similar, no matter how close they are. There are two factors that are responsible for this variation :

Phenotypic factors: the external factors like food, climate, the way of nurturing etc. These variations are not inheritable.Genotypic factors: these characters are gene governed and are inheritable.

The variations because of (2) are called “genetic diversity” of a particular species. The rich genetic diversity is of immense use to us and also to nature. Development of improved plants or race improvisation of domestic animals is possible through this.

We are fast narrowing down the global natural genetic diversity of animals and plants by our un mindful modernization activities. The loss is great and unrepairable.


Related Questions

in which country was the goldfish originally domesticated

Answers

The goldfish is believed to have been originally domesticated in China more than a thousand years ago, during the Tang Dynasty.

which of the following is correct about fermentation? select all that apply. glucose is only partially broken down. pyruvate is the final electron acceptor that completes the redox balance. atp produced is similar to aerobic respiration takes place whether or not oxygen is present.

Answers

The options which are correct about fermentation are: Glucose is only partially broken down. ATP produced is similar to aerobic respiration, Takes place whether or not oxygen is present.

Fermentation is a metabolic process that converts sugar to acids, gases, or alcohol. It is an anaerobic process, meaning that it takes place in the absence of oxygen. The process of fermentation releases energy from the oxidation of organic compounds such as glucose, sucrose, or lactose, by using an organic molecule as a final electron acceptor instead of oxygen.

In fermentation, glucose is only partially broken down, producing a limited amount of ATP. Additionally, the ATP produced is similar to aerobic respiration, and fermentation takes place whether or not oxygen is present.

Pyruvate is not the final electron acceptor that completes the redox balance in fermentation; instead, an organic molecule is used as the final electron acceptor.

For more such questions on fermentation, click on:

https://brainly.com/question/11554005

#SPJ11

What is interspecific competition?
What is direct competition?
If the population of a species increases or decreases, what happens to the species that consumes them?
What is adaptation?
What is a mutation?
What is genetic drift?
Why is genetic variation beneficial?
What is altruistic behavior? Give an example.
How are artificial selection and genetic modification similar?
What is natural selection?
Are organisms able to adapt to their environment quickly?
What was mostly responsible for the “great dying”?

Answers

The competition between members of different species is called interspecific competition.

What is an example of adaptation?

A variation can be underlying, meaning it is an actual piece of the organic entity. Behavioral adaptations can also affect an organism's response to its environment. An illustration of an underlying transformation is the manner in which a few plants have adjusted to life in dry, hot deserts.

An illustration of mutation?

A transformation is a change that happens in our DNA grouping, either because of slip-ups when the DNA is replicated or as the consequence of natural factors, for example, UV light and tobacco smoke.

To know more about species visit :-

https://brainly.com/question/13259455

#SPJ1

Answer:

The competition between members of different species is called interspecific competition.

Explanation:

what type of mutation is huntington disease

Answers

HD is caused by a mutation in the gene for a protein called huntingtin. The defect causes the building blocks of DNA called cytosine, adenine, and guanine (CAG) to repeat many more times than they normally do. Most people have fewer than 27 CAG repeats in their HD gene, so they are not at risk for the disease

b. Describe the fragile ecosystems in your environment that need protecting.
such as wetlands, desert areas, riparian areas, forested and deforested areas,
etc. How are these areas protected? Provide data from your research to explain
your answers. (3 points)

Answers

Answer:

Explanation:

Fragile Ecosystem is a system which is very tender and under threat of loosing it's original condition and has reached its level of threshold beyond which it would not be able to sustain any damage.

Factors which make an ecosystem fragile are the following :-

1) Anthropogenic - Man is a major agent of change in our ecosystem and is doing great damage to the existing avenues.Distructing ventures of humans can be further divided into :-

a) Economic- Ecosystem equilibrium is disturbed for meagre financial gains.Minerals exploration and Tourism are two major factors for disturbing the

ecosystem.

Ex - Increasing number of hotels coming up in sensitive zones as WESTERN GHATS.

b) Political - Despite continuous reports ad committes on the worsening condition of ecosystems, the recommendations are not executed owing lack of political will and lethargic attitude of

administration

c) Psychological - Inhabitants as well as policy makers don't consider the protection of ecosystem at war footing because psychologically they dont consider it as a real threat and hold no responsibility for the outcomes

Regions in India having fragile ecosystem are:-

1)WWestern Ghats which are also under biodiversity rich list of UNESCO

2) Himalyan Mountains ranging from Kashmir to North East India.

3) Sunderban which is the largest delta in the world is also a fragile zone.

India has a well researched strategy to support the fragile ecosystems but effective implementation along with general awareness among the masses about its crucial role in the environment needs to be emphasised.

explain how the skeletal system effects other body systems.

Answers

The bones of the skeletal system serve to protect the body's organs, support the weight of the body, and give the body shape. The muscles of the muscular system attach to these bones, pulling on them to allow for movement of the body.

Internal support for the human body is provided by the skeleton. Around 270 bones make up its structure at birth; by adulthood, after certain bones have fused together, this number drops to approximately 206 bones. The amount of bone mass in the skeleton accounts for around 14% of total body weight (roughly 10–11 kg for the average person) and achieves its maximum mass between the ages of 25 and 30.

The axial and appendicular skeletons of the human body are distinct from one another. The axial skeleton is made up of the spinal column, rib cage, skull, and other supporting bones. The shoulder girdle, pelvic girdle, and bones in the upper and lower limbs make up the appendicular skeleton, which is connected to the axial skeleton.

To know more about skeletal system click here:

https://brainly.com/question/1283837

#SPJ4

what was the Mesozoic terrestrial reptile called that walked in an upright stance.

Answers

The Mesozoic terrestrial reptile that walked in an upright stance is called the dinosaur.

Dinosaurs are a group of reptiles that lived during the Mesozoic era, which is also known as the Age of Reptiles. They were the dominant terrestrial vertebrates for over 135 million years, until their extinction at the end of the Cretaceous period.

They were able to walk in an upright stance due to their skeletal structure and musculature that allowed them to support their massive bodies on two legs instead of four. Some examples of dinosaurs that walked on two legs include the T-Rex, Velociraptor, and Stegosaurus.

To know more about dinosaur refer here:

https://brainly.com/question/7104775#

#SPJ11

What is the smallest subunit of muscle contraction, which is measured from z-line to z-line?

Answers

The smallest subunit of muscle contraction, which is measured from z-line to z-line is called a sarcomere. The movement that occurs in muscle tissue as a result of a stimulus is known as muscle contraction.

Muscle fibers use ATP to produce tension and generate movement through the contractile process. It is an important physiological mechanism that aids in the maintenance of posture, movement, and the performance of vital life processes.

Sarcomere is the structural and functional unit of a myofibril in striated muscle, with Z discs (Z lines) defining its boundaries. It is the region of the myofibril between two adjacent Z-lines that undergoes shortening when muscle fibers contract.

The thin filaments (composed of actin, tropomyosin, and troponin proteins) are attached to the Z-discs, while the thick filaments (composed of myosin proteins) are anchored in the center of each sarcomere, where they overlap with the thin filaments. When muscle fibers contract, the myosin heads pull the thin filaments closer to the center of the sarcomere, resulting in the shortening of the sarcomere and overall muscle contraction.

know more about sarcomere here

https://brainly.com/question/14005497#

#SPJ11

if you were writing about hylobates agilis and homo neanderthalensis at the same time, would you need to change your abbreviations? why or why not? if you needed to change them, what would the new abbreviations be?

Answers

Yes, you would need to change your abbreviations. The abbreviation for Hylobates agilis is H. agilis, while the abbreviation for Homo neanderthalensis is H. neanderthalensis.

If both species are being discussed in the same document, it is important to differentiate between the two. This can be done by changing the abbreviations so that they are more distinct.

For example, H. agilis could become H. a. and H. neanderthalensis could become H. n. These more distinct abbreviations will serve to avoid confusion and help differentiate which species is being referred to.

Know more about Hylobates agilis here

https://brainly.com/question/8703871#

#SPJ11

Maintaining hydration during endurance events is most likely to be challenging due to _____.a. lack of access to hydration liquids b. a decrease in kidney function during exercise c. an increase in blood pressure during exercise d. sweat rates that exceed gastric emptying and absorption rates

Answers

Maintaining hydration during endurance events is most likely to be challenging due to sweat rates that exceed gastric emptying and absorption rates. The correct answer is Option D.

What is endurance?

Endurance is the ability to maintain or repeat an activity for a prolonged period of time. Physical endurance refers to a person's ability to persist in physical activities for an extended period of time or to perform many repetitions of a movement. The following are examples of endurance activities:

Running is a form of aerobic endurance. Running, biking, swimming, and rowing are examples of activities that use endurance. The body's energy needs are met by aerobic endurance activities. The body's ability to consume and use oxygen (respiration) is improved by such activities.

Hydration during endurance events

Maintaining hydration during endurance events is critical for maintaining health and performance. Dehydration may lead to cramps, heat exhaustion, and heat stroke, as well as impairing endurance performance. Sweat rates that surpass gastric emptying and absorption rates are the most common reason of decreased hydration. When the body's core temperature rises, it begins to perspire to maintain its temperature.

Perspiration is the body's mechanism of cooling itself. As a result, sweat rates increase in response to higher temperatures. Sweat has to be replaced to keep hydrated. Sweat, on the other hand, may not be replaced as quickly as it is released. Sweat rates surpass gastric emptying and absorption rates, leading to dehydration. As a result, it is critical to drink enough fluids during endurance events.

Learn more about Endurance here: https://brainly.com/question/28712439

#SPJ11

which of the following would most directly interfere with sperm production? which of the following would most directly interfere with sperm production? use of synthetic steroids (testosterone) low sperm count interruption of sustentocytes' production of abp ingestion of a substance that mimicked inhibin

Answers

The following would most directly interfere with sperm production: b. interruption of sustentocytes production of ABP.

The correct option is b. interruption of sustentocytes' production of ABP

Sustentocytes, or Sertoli cells, are the major supporting cells in the seminiferous tubules of the testes. They are responsible for a variety of functions in the testes, including the production of androgen-binding protein (ABP), which binds testosterone and makes it available to developing sperm for their proper maturation.

ABP is a glycoprotein synthesized and secreted by sustentocytes that binds with high affinity to testosterone and its 5α-dihydro derivative (DHT) in the extracellular fluid, preventing their diffusion into the seminiferous tubule lumen or out of the testis. ABP facilitates the uptake of testosterone and DHT by germ cells and stimulates the spermatogenic process.

Therefore, interruption of sustentocytes production of ABP would most directly interfere with sperm production.

Use of synthetic steroids such as testosterone can increase the level of testosterone in the body and, if abused, may suppress the body's natural production of testosterone, leading to reduced sperm production.

Ingestion of a substance that mimics inhibin, which is a hormone produced by Sertoli cells that suppresses FSH production by the anterior pituitary gland, would also interfere with sperm production.

Finally, low sperm count is not a cause of but rather a result of reduced sperm production.

Therefore, the answer to the question is interruption of sustentocytes production of ABP.

To know more about sustentocytes  refer here:

https://brainly.com/question/29749213#

#SPJ11

Complete Question:

Which of the following would most directly interfere with sperm production?

a.low sperm count

b. interruption of sustentocytes' production of ABP

c. ingestion of a substance that mimicked inhibin

d. use of synthetic steroids (testosterone)

cercopithecines are primarily terrestrial quadrupeds and omnivorous. group of answer choices true false

Answers

The given statement "Cercopithecines are primarily terrestrial quadrupeds and omnivorous" is true. Because they are adapted to life on the ground and are often found in open habitats such as grasslands, savannas, and forests.

Cercopithecines are a subfamily of Old World monkeys that includes many species of terrestrial quadrupeds and omnivores. Cercopithecines are generally terrestrial and adapted to life on the ground, but some species are also arboreal (tree-dwelling).

They have a diverse diet that includes fruits, leaves, insects, and small animals, and their teeth and digestive system are adapted to process a wide range of food items. While some cercopithecine species are arboreal (tree-dwelling), the majority of them are primarily terrestrial.

Cercopithecines are important to the ecosystem as seed dispersers and predators of insects and small animals. However, they are also sometimes considered pests, as they can damage crops and raid human settlements for food.

To know more about Cercopithecines here

https://brainly.com/question/25676394

#SPJ4

what explains the differences among the four illustrations? is there anything that confirms or contradicts the order in which you arranged the illustrations?

Answers

The differences among the four illustrations are due to the presence of lave and mutation within the population of mice. There is no information that confirms or contradicts the order in which the illustrations are arranged.

The illustrations likely depict a population of mice with varying characteristics, such as fur color, tail length, or other physical features. These differences may be due to genetic mutations that have arisen over time or to the presence of different genetic variations within the population.

Additionally, environmental factors, such as availability of food or predation pressure, may also contribute to differences among the mice. However, without more information, it is not possible to confirm or contradict the order in which the illustrations are arranged, as the order may have been arbitrary or based on some other criteria.

To know more about illustrations, here

brainly.com/question/28298427

#SPJ4

all of the following characteristics are seen in phylum arthropoda except group of answer choices bilateral symmetry. an open circulatory system. protostome development. a pseudocoelom. three embryonic germ layers.

Answers

Bilateral symmetry is not seen in phylum Arthropoda, as these organisms possess an exoskeleton and typically have a segmented body plan that does not result in bilateral symmetry. Instead, Arthropods typically have radial symmetry, which can be seen in the body of a spider or butterfly.

Other characteristics of Arthropods include an open circulatory system, where the heart pumps hemolymph (the arthropod version of blood) throughout the body, protostome development, which is the development of a digestive system from a hollow blastula, a pseudocoelom, which is a body cavity formed from mesoderm and not lined by epithelium, and three embryonic germ layers, which are endoderm, mesoderm, and ectoderm.

Know more about Bilateral symmetry here

https://brainly.com/question/15970176#

#SPJ11

breanna and kevin learned that fossil fuels, such as coal and oil, release energy when they are burned. breanna believes this energy comes from the ancient plants and animals that formed fossil fuels, but kevin says the energy in fossil fuels comes from the sun. explain who is right and why.

Answers

Answer: Breanna is correct.

Explanation: When fossil fuels are burned the ancient plants and animals inside create carbon and all that heat turns water into steam which goes into power turbines to create energy.

What is the metabolic pathway that releases energy by breaking down complex molecules into smaller, simpler compounds?

Answers

The metabolic pathway that releases energy by breaking down complex molecules into smaller, simpler compounds is called catabolism. Catabolism involves breaking down large molecules, like carbohydrates and proteins, into smaller molecules such as water, carbon dioxide, and energy.

Metabolism refers to all of the chemical reactions that occur in a cell or organism. It includes both anabolism and catabolism. Anabolism refers to the process of building larger, more complex molecules from smaller, simpler ones. Catabolism, on the other hand, refers to the process of breaking down larger, more complex molecules into smaller, simpler ones. During catabolism, energy is released from the chemical bonds of the larger molecules, this energy can be used to power cellular processes or stored for later use.

Learn more about catabolism: https://brainly.com/question/12875784

#SPJ11

Which of the following is a common danger of commercial fishing?
A.An increase in biodiversity

B.Improved water quality

C. An improved human diet

D. An increase in human fatality

Answers

Answer: D

Explanation:

Even before the structure of DNA was known, studies indicated that the genetic material must have the following properties:
•be able to store information
•be consistently replicated between generations
•be able to allow for changes, and thus evolution, to occur
Explain how the structure of DNA gives it these three properties. Write one or two sentences per property.

Answers

The double helix structure of DNA allows it to store information in the sequence of its nucleotides. DNA replication is possible because of the complementary base pairing, which allows each strand of DNA to serve as a template for the formation of a new complementary strand. The occurrence of mutations during replication and other processes, as well as the ability of DNA to be repaired, allow for genetic variation and evolution to occur.

How does the complementary base pairing of DNA contribute to its ability to store information?

The complementary base pairing of DNA allows for the specific sequence of nucleotides to act as a code that stores genetic information. The order of the bases determines the genetic instructions for the organism.

How does the process of DNA repair allow for evolution to occur?

The process of DNA repair allows for mistakes or mutations in DNA to be corrected, preventing genetic abnormalities from being passed on to the next generation. However, mutations that are not repaired can lead to genetic variation and may provide an advantage or disadvantage to the organism in certain environments, ultimately allowing for evolution to occur.

Learn more about DNA here:

https://brainly.com/question/264225

#SPJ1

tony is diagnosed with acid reflux. this is a condition in which stomach secretions which contain hydrochloric acid or hcl, regurgitate (reflux) out of the stomach and into the esophagus. stomach secretions are very acidic with a ph around 2.0. the acids damage the esophagus and it is felt as heartburn. this painful condition can be treated with over-the-counter (otc) antacids. what do you think these antacids are?

Answers

Weak bases, like sodium bicarbonate (NaHCO3) or calcium carbonate (CaCO3). Antacids reduce heartburn, acid indigestion, sour stomach, and stomach distress by neutralising stomach acid.

A component called simethicone, which aids in gas removal, is also found in several antacids. Aluminum and magnesium are two components found in some antacids that may result in constipation or diarrhoea.

Antacids include, for instance:

Aluminium hydroxide gelCaustia carbonate (Alka-Seltzer, Tums)hydrated magnesium (Milk of Magnesia)Rolaids, Mylanta, Maalox, Gaviscon, and GelusilPepto-Bismol

An antacid should be taken exactly as prescribed by a physician or per the directions on the packaging. To get faster relief while taking the tablets, chew them thoroughly before swallowing. To avoid taking too much or using too many antacids, be sure to adhere to the label's instructions.

Learn more about antacid here:

https://brainly.com/question/11384558

#SPJ1

explain why it is important to have a variety of organisms in a community of interacting species give an example

Answers

It is important to have a variety of organisms in a community of interacting species because each species plays a unique role in maintaining the balance and stability of the ecosystem.

A diverse community is more resilient to changes or disturbances, as it can better cope with changes in environmental conditions and species loss. For example, if a predator species were to go extinct, it could lead to a proliferation of its prey, which could in turn have cascading effects on other species in the community. Similarly, the loss of a plant species could have negative impacts on pollinators and herbivores that rely on that plant for food or habitat. Therefore, a variety of species ensures that different niches are filled and the ecosystem is more stable and sustainable.

To know more about ecosystem click here:

brainly.com/question/12628269

#SPJ4

what part of the temporal bone does the mandible articulate with?

Answers

The mandible articulates with the articular tubercle of the temporal bone to form the temporomandibular joint

why is less atp produced by anaerobic respiration than by aerobic respiration? anaerobic respiration does not make use of an electron transport chain. anaerobic respiration uses a final electron acceptor that is less electronegative than o2, which is used as the final electron acceptor in aerobic respiration. anaerobic respiration does not make use of the citric acid cycle. all of these answers are correct.

Answers

Anaerobic respiration produces less ATP than aerobic respiration because anaerobic respiration does not make use of an electron transport chain. The correct answer to the question is "anaerobic respiration does not make use of an electron transport chain."

The electron transport chain is a collection of proteins that transfer electrons from NADH and FADH2 to O2, generating a proton gradient across the inner mitochondrial membrane. This gradient is utilized by ATP synthase to generate ATP in the oxidative phosphorylation process.

An important point to remember is that anaerobic respiration uses a final electron acceptor that is less electronegative than O2, which is used as the final electron acceptor in aerobic respiration. The anaerobic respiration process occurs when there is no oxygen in the body.

This lack of oxygen forces the body to convert glucose to energy through fermentation. The fermentation process generates only two ATP molecules per glucose molecule. This energy production process is significantly lower than what is produced by aerobic respiration, which produces 36 ATP molecules per glucose molecule.

Know more about Anaerobic respiration here:

https://brainly.com/question/13943624

#SPJ11

Obligate anaerobes which are sensitive to O2 would be found growing
A. only at the very top of a tube of thioglycolate broth
B. approximately one-third of the way down the thioglycolate broth.
C. only at the bottom of a tube of thioglycolate broth.
D. throughout a tube of thioglycolate broth. 

Answers

Answer:

Explanation:

Obligate anaerobes are microorganisms that require an oxygen-free environment to grow and are sensitive to oxygen. Thioglycolate broth is a common culture medium used for growing microorganisms and is commonly used to test the oxygen requirements of bacteria.

The medium in a tube of thioglycolate broth is rich in nutrients and contains a reducing agent, which helps to create an anaerobic environment in the lower part of the tube. The oxygen concentration gradually decreases as you move down the tube, and the concentration of reducing agents increases.

Based on this information, we can determine that obligate anaerobes that are sensitive to O2 would be found growing at the bottom of a tube of thioglycolate broth, where the oxygen concentration is lowest and the environment is most anaerobic. Therefore, the correct answer is option C: only at the bottom of a tube of thioglycolate broth.

which of the following is an example of species interaction(s) leading to adaptive radiation? which of the following is an example of species interaction(s) leading to adaptive radiation? a flower has evolved to be pollinated by many different species of unrelated insects; these insects also pollinate many different species of flowers. flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to different heights that reflect their host population mean height. a flower is pollinated by different members of the same genus of insect during different times of day. species a pollinates in early morning, species b visits in the late morning, species c visits during mid-day, and species d collects nectar and pollen in the evening. a flower has evolved in tandem with its pollinator and relies on it exclusively for pollination and sexual reproduction. flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to similar heights.

Answers

An example of species interaction(s) leading to adaptive radiation is the flower that has evolved to be pollinated by many different species of unrelated insects; these insects also pollinate many different species of flowers (A).

The evolutionary process whereby one species gives rise to several species that adapt to different ecological niches is known as adaptive radiation. Adaptive radiation is a mechanism by which a single species becomes multiple species that live in different environments and have unique characteristics. This happens because the original species divides into several new species that are better adapted to their environments.

Adaptive radiation is a result of environmental pressures. It occurs when a single ancestral species diversifies into many descendant species. For example, a flower has evolved to be pollinated by many different species of unrelated insects and these insects also pollinate many different species of flowers.

Your options aren't well arranged, but most probably your options were

A. a flower has evolved to be pollinated by many different species of unrelated insects; these insects also pollinate many different species of flowers.

B. flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to different heights that reflect their host population mean height.

C. a flower is pollinated by different members of the same genus of insect during different times of day. Species a pollinates in early morning, species b visits in the late morning, species c visits during mid-day, and species d collects nectar and pollen in the evening.

D. a flower has evolved in tandem with its pollinator and relies on it exclusively for pollination and sexual reproduction.

flowers grow to different heights at different altitudes on a mountain. when grown in a common garden these organisms can interbreed and grow to similar heights.

Thus, the correct option is A.

For more information about adaptive radiation refers to the link: https://brainly.com/question/14154757

#SPJ11

which event occurs when myocardial oxygen demand exceeds oxygen supply?

Answers

The correct option is D, Lactic acid is formed and irritates myocardial nerve fibers occurs when myocardial oxygen demand exceeds oxygen supply.

Myocardium refers to the muscular tissue of the heart that is responsible for contracting and pumping blood throughout the body. It is one of the three main layers of the heart wall, along with the endocardium and epicardium. The myocardium is made up of specialized cardiac muscle cells called cardiomyocytes that are interconnected through intercalated discs.

These cells contract rhythmically and synchronously in response to electrical impulses generated by the sinoatrial (SA) node, which is located in the right atrium of the heart. The myocardium receives its blood supply from the coronary arteries, which branch off from the aorta and encircle the heart. If these arteries become blocked or narrowed, it can lead to a heart attack or myocardial infarction, which can cause irreversible damage to the heart muscle.

To learn more about Myocardial visit here:

brainly.com/question/30510298

#SPJ4

Complete Question: -

Which event occurs when myocardial oxygen demand exceeds oxygen supply?

a.Myocardial cells increase metabolism.

b.Unstable angina progresses to an ST-segment myocardial infarction (STEMI).

c.The body compensates by decreasing the heart rate.

d.Lactic acid is formed and irritates myocardial nerve fibers.

which biogeochemical cycle can be influenced by human activity and cause eutrophication of a local water supply? responses nitrogen cycle nitrogen cycle carbon cycle carbon cycle water cycle water cycle oxygen cycle

Answers

The oxygen cycle is the process by which oxygen is released into the atmosphere and then taken up into plants and animals for respiration. Human activity such as burning fossil fuels can lead to an increase in air pollution which can lead to an increase in nitrogen and phosphorus levels.

These nutrients then enter the water supply and can cause eutrophication. Eutrophication is when excess nutrients stimulate the growth of algae which then consume oxygen from the water and lead to an oxygen decrease in the water supply.

This can lead to a decrease in biodiversity of aquatic species due to the decrease in oxygen levels. Therefore, human activities can influence the oxygen cycle and cause eutrophication.

Know more about Eutrophication here

https://brainly.com/question/13232104#

#SPJ11

a condition of reduced muscle tension, cortical activity, heart rate, breathing rate, and blood pressure is termed:

Answers

The condition of reduced muscle tension, cortical activity, heart rate, breathing rate, and blood pressure is termed as "Relaxation Response."

The relaxation response is the opposite of the body's stress response, and it's a state of deep rest that enhances the body's ability to heal and recover from stress-related symptoms.

According to Herbert Benson, M.D., who founded Harvard's Mind/Body Medical Institute, "we use the relaxation response to change the fundamental state of our physical and mental functioning, causing a reduction in anxiety, insomnia, and hypertension."

The relaxation response is characterized by the following signs: Reduction in blood pressure, Slow breathing rate, Improved metabolism, Decreased heart rate, Reduced muscle tension, Less perspiration, Better sleep patterns, Enhanced immune function, Lower blood lactate levels and Improved mood.

To know more about Relaxation Response, refer here:

https://brainly.com/question/13834897#

#SPJ11

does the difference in sensitivity between the fingertip and the back of the neck help our bodies to maintain homeostasis? if so, in what way?

Answers

While the sensitivity differences between the fingertips and the back of the neck are not directly related to homeostasis, they do play a role in the body's ability to respond to external stimuli and maintain overall health and wellbeing.

The difference in sensitivity between the fingertips and the back of the neck is due to variations in the density and distribution of sensory receptors in the skin. While the fingertips have a high concentration of touch receptors, the back of the neck has fewer and less sensitive receptors.

In terms of maintaining homeostasis, the sensitivity differences between these areas do not have a direct role. Homeostasis refers to the body's ability to maintain a stable internal environment, and it involves a range of physiological processes such as temperature regulation, fluid balance, and metabolic homeostasis.

However, the sensitivity differences in different areas of the skin can play a role in the body's response to external stimuli, such as temperature changes, pressure, and pain. The fingertips, for example, are highly sensitive to touch and pressure, which can help us detect and respond to changes in the environment. Meanwhile, the back of the neck is less sensitive, which may help to prevent overstimulation and fatigue.

To know more about homeostasis

brainly.com/question/25864161

#SPJ4

if a restriction enzyme that recognizes ggcat and cuts between the two guanine residues is mixed with dna that has the sequence ccgattataatcccgcggcatattagggcgg, how many pieces would the resulting product be?

Answers

The restriction enzyme that recognizes ggcat and cuts between the two guanine residues is HindIII. When HindIII is mixed with the DNA sequence ccgattataatcccgcggcatattagggcgg, the resulting product would be two pieces.

What are restriction enzymes?

Restriction enzymes are proteins that are used in molecular biology to break down DNA molecules by recognizing specific nucleotide sequences and cleaving them. Restriction enzymes are used in genetic engineering to create recombinant DNA molecules.

How do restriction enzymes work?

Restriction enzymes recognize and bind to specific nucleotide sequences in DNA known as recognition sites. The recognition site is usually a specific palindromic sequence of four to six base pairs. Palindromic means that the nucleotide sequence is identical when read in the forward or backward direction.

Restriction enzymes cut DNA by creating a break in both strands of the DNA helix at specific points relative to the recognition site. This creates "sticky ends" that can be joined to other DNA molecules that have complementary overhanging ends.

The recognition sequence of HindIII is 5' G-A-N-T-C 3' and 3' C-T-N-A-G 5'. When HindIII cuts the DNA sequence ccgattataatcccgcggcatattagggcgg, it will cleave between the two guanine residues (G) in the recognition sequence ggcat, resulting in two fragments:ccgattataatcccgcggcat  |  attagggcgg  (sticky ends are indicated by vertical bars)

To know more about restriction enzyme refer to-

brainly.com/question/29882269#
#SPJ11

which process may affect the evolution of color patterns in poeciliids?

Answers

The evolution of color patterns in poeciliids can be influenced by a variety of processes, including:

Sexual selectionNatural selectionGenetic drift

What are  poeciliids?

Poeciliids are a family of freshwater fish that are commonly known as livebearers because they give birth to live young instead of laying eggs. Poeciliids are found primarily in the Americas, ranging from the southern United States down to Argentina, and they are especially diverse in Central America and the Caribbean.

Poeciliids are small fish, typically reaching only a few inches in length, and they come in a wide range of colors and patterns. Some of the most well-known poeciliids include guppies, mollies, swordtails, and platies, which are popular aquarium fish due to their colorful appearance and ease of care.

Learn about Natural selection here https://brainly.com/question/15577096

#SPJ1

Other Questions
How does Macbeth and the movie gladiator relate? The motion of Earths molten rock shows characteristic patterns which can be analyzed and explained scientifically. Such analysis and explanation is impossible without understanding the principles of which kind of energy?- Chemical- Electrical- Thermal- Radiant What are the measures of the missing angles? Please help 1. Read the following paragraph from "Resistance to Civil Government" by HenryDavid Thoreau:But a government in which the majority rule in all cases can notbe based on justice, even as far as men understand it. Can therenot be a government in which the majorities do not virtuallydecide right and wrong, but conscience? - in which majoritiesdecide only those questions to which the rule of expediency isapplicable? Must the citizen ever for a moment, or in the leastdegree, resign his conscience to the legislator? Why has everyman a conscience then? I think that we should be men first, andsubjects afterward. It is not desirable to cultivate a respect forthe law, so much as for the right. The only obligation which I havea right to assume is to do at any time what I think right.Analyze Thoreau's choice to use rhetorical questions in this paragraph. How do therhetorical questions contribute to the essay's power? Be sure to include specificdetails from the text to support your answer. (10 points) middle school english50 points!!!PLEASE HELP ILL GIVE BRAINLYthank you what was the original purpose of profiling? to identify suspected terrorists attempting to enter the united states to limit the use of police discretion to help catch drug couriers attempting to enter the united states to reduce the risk of biased policing The table shows values for functions f(x) and g(x) . x f(x) g(x) 1 14 14 3 2 4 5 5 3 7 9 7 9 6 6 11 11 3 What are the known solutions to f(x)=g(x) ? Select each correct answer. Responses 1 1 5 5 7 7 9 9 11 11 how is the demand curve perceived by a perfectly competitive firm different from the demand curve perceived by a monopolist? mobile company manufactures and sells two products, tablet computers (60% of sales) and smartphones (40% of sales). fixed costs are $1,112,440, and the weighted-average contribution margin per unit is $274. how many units of each product are sold at the break-even point? You make $45.00 babysitting for eight hours. How much do you make per hour?I make ------------- dollars per hour babysitting. This table shows the production possibility schedule for several toothpaste companies.Use the numbers to place the companies in order of greatest comparative advantage to least comparative advantage in producing small tubes of toothpaste. while visiting a family's home, the community health nurse finds that the two children in the home were exposed to chickenpox. assessment of the children reveals no signs of fever or lesions. the nurse determines that the children are in which stage of the disease? what advantages do omnibus appropriations bills provide? the ability to adapt to increases or decreases in demand for processing or data storage is known as . what is the formula for ASSUMED MEAN !!??? . . . . btw hello guyyzz !! reggie is looking over his basketball statistics for the last 5 games , he scored the following number of points 12,15,18,20,5 .which of the following values calculated from his data set will not change if he scores 18 points in his next game ? A.the mean B.The medium C.the mode D.the range global corp. sells its output at the market price of $13 per unit. each plant has the costs shown below: units of output total cost ($) 0 8 1 11 2 17 3 26 4 38 5 53 6 71 7 92 what is the breakeven quantity? enter 0 if total profit is always negative. please specify your answer as an integer. Which of the following pairs consists of equivalent fractions?3/12 and 3/4 5/7 and 7/516/20 and 15/256/9 and 10/15 A sample of hydrogen nitrite or nitrous acid, HNO2 contains 8.8 x 1022 atoms. a. How many moles of nitric acid are in the sample? b. How much mass of nitric acid are in the sample? the target rate of gdp growth is group of answer choices negative to reduce inflation about 3% 0% as high as possible