Hey loves!!! Can any of you lovely people help me with this question?

Hey Loves!!! Can Any Of You Lovely People Help Me With This Question?

Answers

Answer 1

Answer:

AAS

Step-by-step explanation:

As we can see, they tell us that both of the angles on the bottom are congruent. Since they share a side, that means that one side is congruent too. So it must be two angles and one side. It can't be ASA, because the congruent side is not in between the two congruent angles, so it must be AAS

Answer 2

Hey There!!

Your correct choice will be AAS Theorem.

Step-by-step explanation:

Because, two angles and any side of one triangle are congruent to two angles and any side of another triangle, then these triangles are congruent Thus, given a triangle ADB and CDB. ∠BAD = ∠BCD = 90°. (Angle), Then, BD = BD (The common side) As given AAS Theorem. Therefore, ∆ADB ≅ ∆CDB by the AAS theorem.

Hope This Explaining was not confusing . . .

By ☆Itsbrazts☆


Related Questions

If a polynomial function f(x) has roots -9 and 7 -i, which must be a factor of f(x)

Answers

Answer:

(x + 9) (x - 7)

Step-by-step explanation:

when we put x + 9 = 0 then x = -9 as it's the root of the fuction.

same thing here: x - 7 = 0 then x = 7

Solve by the quadratic formula: x^2= 6x-4

Answers

Answer:

3 [tex]\pm[/tex] [tex]\sqrt{5}[/tex].

Step-by-step explanation:

x^2 = 6x - 4

x^2 - 6x + 4 = 0

Now, we can use the quadratic formula to solve.

[tex]\frac{-b\pm\sqrt{b^2 - 4ac} }{2a}[/tex], where a = 1, b = -6, and c = 4.

[tex]\frac{-(-6)\pm\sqrt{(-6)^2 - 4 * 1 * 4} }{2 * 1}[/tex]

= [tex]\frac{6\pm\sqrt{36 - 4 * 4} }{2}[/tex]

= [tex]\frac{6\pm\sqrt{36 - 16} }{2}[/tex]

= [tex]\frac{6\pm\sqrt{20} }{2}[/tex]

= [tex]\frac{6\pm2\sqrt{5} }{2}[/tex]

= 3 [tex]\pm[/tex] [tex]\sqrt{5}[/tex]

x = 3 [tex]\pm[/tex] [tex]\sqrt{5}[/tex].

Hope this helps!

In the table, describe the shape of the cross section formed when a particular plane passes through the cylinder.

Answers

triangle is the best answer

Answer:

Step-by-step explanation:

11 POINTS! GEOMETRY!! Find the area of the composite function and explain how you broke the shape into pieces to find the area.

Answers

Answer:

370 mm²

Step-by-step explanation:

The area of this figure can be calculated by taking the whole figure as a full rectangle, and consider the part that is cut out from the middle of the shape as another rectangle.

Find the area of the cut-out part and subtract from the area of the full rectangular shape to get the area of the composite figure.

=>Area of full rectangular shape:

Length = 30 mm

Width = 15 mm

Area = L * B = 30*15 = 450 mm²

=>Area of the cut-out Rectangle part:

Length = 10 mm

Width = 8 mm

Area = 10*8 = 80 mm²

=>Area of composite figure = 450 mm² - 80 mm² = 370 mm²

Please help out show work ty!

Answers

Answer:

C

Step-by-step explanation:

This is because it has a constant rate of change.

5 x 1.5 = 7.5

6 x 1.5 = 9

7 x 1.5 = 10.5

You can find this image by dividing y by x and testing this rate of change on the other y values. Thus C is correct.

PLEASE HELP Question 1(Multiple Choice Worth 4 points) (08.03)A system of equations is given below: y = –2x + 1 6x + 2y = 22 Which of the following steps could be used to solve by substitution? 6x + 2(−2x + 1) = 22 −2x + 1 = 6x + 2y 6(−2x + 1) + 2y = 22 6(y = −2x + 1) Question 2(Multiple Choice Worth 4 points) (08.03)Solve the system of equations and choose the correct answer from the list of options. d + e = 15 −d + e = −5 Label the ordered pair as (d, e). (0, 0) (10, −5) (5, 10) (10, 5) Question 3(Multiple Choice Worth 4 points) (08.03)A set of equations is given below: Equation H: y = −x + 2 Equation J: y = 3x − 4 Which of the following steps can be used to find the solution to the set of equations? −x = 3x − 4 −x +2 = 3x −x + 2 = 3x − 4 −x + 1 = 3x + 2 Question 4(Multiple Choice Worth 4 points) (08.03)A set of equations is given below: Equation M: y = 3x + 4 Equation P: y = 3x + 7 Which of the following options is true about the solution to the given set of equations? No solution One solution Two solutions Infinite solutions Question 5(Multiple Choice Worth 4 points) (08.03)Solve the system of equations and choose the correct answer from the list of options. x + y = −3 y = 2x + 2 five over 3 comma 4 over 3 negative 5 over 3 comma negative 4 over 3 negative 3 over 5 comma negative 3 over 4 3 over 4 comma 3 over 5

Answers

Answer:

6x + 2(−2x + 1) = 22

Step-by-step explanation:

Answer: The answer is 6x + 2(−2x + 1) = 22

Which of the following is not a congruence theorem or postulate A. SSA B. SAS C. AAS D. SSS

Answers

Answer:ITS A

Step-by-step explanation:

SAS: side angle side

SSA: is not a congruence theorem

AAS:angle angle side

SSS:side side side

Answer:

The answer is A.

Step-by-step explanation:

Just took the test

One equation 0f a pair of dependent linear equations is -5x+7y=2.The second equation can be a)10x-14y=-4 b)-10x-14y+4=0 c)-10x+14y+4=0 d)10x+14y=-4

Answers

Answer:

a) 10x - 14y = -4

Step-by-step explanation:

Two equations linear dependent if you can write one as a multiple of the other. It means that the equation that is a linear dependent with -5x+7y=2 is:

10x - 14y = -4

Because it can be written as:

-2(-5x+7y) = -2(2)

So, this equation is equivalent to -5x + 7y = 2

A track coach is trying to improve the 50 -meter-dash times of the track team. He times each student and then implements a month-long training program. At the end of the program, he timed each of the students again. The box plots show the number of seconds it took the students to run the 50 -meter-dash before and after the program. Using the plots, how much did the median change?

Answers

Answer:

-5

Step-by-step explanation:

Given the two box plots showing the number of seconds the students completes the 50-meter-dash race before and after the program, we are to determine the difference between the median value of seconds before and after the program.

Median in a box plot is represented by the vertical line that divides the rectangular box in a box plot.

Thus, the median before the program = 15 seconds

The Median after the program = 10 seconds

The median change = 10 - 15 = -5 seconds.

This means, after the program, most of the students now finish the 50-meter-dash faster, about 5 seconds less the former seconds used before the program.

Answer:

-5

Step-by-step explanation:

i did it on Imagine Math and i got it correct!

Which of the following correlation coefficients would correspond to a strong linear relationship in a data set? a. 0 b. 7 c. 0.9 d. 0.4

Answers

Answer: c) 0.9

The correlation coefficient r is always between -1 and 1, inclusive of both endpoints. We can write [tex]-1 \le r \le 1[/tex]

If r = 0, then we have no linear correlation at all. If r = 1, then we have perfect positive correlation. If r = -1, then we have perfect negative correlation.

We see that r = 0.9 is close to r = 1, so we have strong positive linear correlation going on here.

Kate opens a savings account with a deposit of $1250. After 2 years, she has
receives $112.50 in interest. What is the annual interest rate?

Answers

Answer:

4.5%

Step-by-step explanation:

Simple interest:

I = Prt

112.5 = 1250(r)(2)

1250r = 56.25

r = 0.045 = 4.5%

Answer: 4.5%

John wants to nail a thumbtack on his circular board, pictured below. If the thumbtack is equally likely to be placed anywhere on the board, what is the probability that the thumbtack will be placed on the inner circle? Use 3.14 for pi , and round your answer to the nearest whole percent. A. 51% B. 55% C. 57% D. 60%

Answers

Answer: A. 51%

Step-by-step explanation:

Area of circle = [tex]\pi r^2[/tex] , where r = radius of the circle.

In the figure below, we have the complete question.

According to that,

Radius of outer circle = 7ft

Radius of inner circle = 5ft

The probability that the thumbtack will be placed on the inner circle

[tex]=\dfrac{\text{Area of inner circle}}{\text{Area of outer circle}}\\\\=\dfrac{\pi (5)^2}{\pi (7)^2}\\\\=\dfrac{25}{49}[/tex][π is canceled from numerator and denominator

in percent, [tex]\dfrac{25}{49}\times100=51.0204081633\%\approx51\%[/tex]

So, the probability that the thumbtack will be placed on the inner circle = 51%

Hence, the correct option is A. 51%.

The direct distance from a starting point to a finish line is 20 miles. Unfortunately, you can't take the direct route. If you travel 16 miles west, how many miles south must you travel to reach the finish line? A. 12 B. 16 C. 4

Answers

Answer:

12

Step-by-step explanation:

This graph shows how the length of a time kayak is rented is related to the rental cost. What is the rate of change shown in the graph?

Answers

Answer:

A.

Step-by-step explanation:

x-15 = 8
A. x= 23
B. x = 7
C. x=-23
D. x=-7

Answers

Answer:

[tex]\boxed{ x = 23}[/tex]

Step-by-step explanation:

=> x - 15 = 8

Adding 15 to both sides

=> x - 15 + 15 = 8 + 15

=> x = 23

Answer:

A. x = 23

Step-by-step explanation:

Step 1: Write out equation

x - 15 = 8

Step 2: Add 15 to both sides (Addition Equality)

x - 15 + 15 = 8 + 15

x = 23

Using the quadratic formula to solve x2 + 20 = 2x, what are the values of x??

These are the options

O 12/21
O 1 2 191
O 1+2,1191
O 12.191​

Answers

[tex]x^2-2x+20=0\implies D=b^2-4ac<0\implies x_1,x_2\notin\mathbb{R}[/tex].

There are no real solutions to the quadratic equation.

Hope this helps.

Please Help! Two lines, A and B, are represented by the following equations: Line A: y = x − 1 Line B: y = −3x + 11 Which of the following options shows the solution to the system of equations and explains why? (3, 2), because the point does not lie on any axis (3, 2), because one of the lines passes through this point (3, 2), because the point lies between the two axes (3, 2), because both lines pass through this point

Answers

Answer:

The last choice (3,2), because both lines pass through this point.

Step-by-step explanation:

For a point to be a solution to a system of linear equations, both equation's lines have to pass through that same point.

Answer: (3, 2), because both lines pass through this point

Step-by-stepexplanation:

This can be solved by substitution. The graph will show the same result.

plz answer this question

Answers

Answer:

D is correct one

Step-by-step explanation:

The pattern consists of repeating 4 faces

1000 is fully divisible by 4

1000/4= 250

The 1000th face ends the pattern of 4

The next, 1001th one is the very first face

Correct choice is D

What is the length of AC?
Please help me ASAP!!!

Answers

Answer:

a

Step-by-step explanation:

PLS HELP THE 1ST PERSON TO ANSWER THIS CORRECTLY AND EXPLAINS IT ILL MARK BRAILIEST. What is the solution to the equation 3.6m − 2.7 = −1.8m? m = 0.25 m = 0.5 m = 1.25 m = 1.5

Answers

Answer:

m=0.5

Step-by-step explanation:

Copy the equation.

3.6m-2.7=-1.8m

Subtract 3.6m from both sides.

-2.7=-5.4m

Divide by -5.4 on both sides.

0.5

pls help me for question no.4

Answers

Answer:

Area of the composite figure = 75.25 cm²

Step-by-step explanation:

Question (4). Given figure is a composite figure having,

(1). Right triangle STU

(2). A kite PSUV

(3). A trapezoid PQRS

Now we will calculate the area of each figure.

(1). Area of the right triangle = [tex]\frac{1}{2}(\text{ST})(\text{TU})[/tex]

                                              = [tex]\frac{1}{2}(3.5)(3)[/tex]

                                              = 5.25 cm²

(2). Area of the kite PSUV = [tex]\frac{1}{2}(\text{Diagonal 1})(\text{Diagonal 2})[/tex]

                                           = [tex]\frac{1}{2}(\text{PU})(\text{SV})[/tex]

                                           = [tex]\frac{1}{2}(\text{TS+RQ})(\text{SV})[/tex]

                                           = [tex]\frac{1}{2}(3.5+7)(6)[/tex] [Since SV = 2 × 3 = 6 cm]

                                           = [tex]3\times 10.5[/tex]

                                           = 31.5 cm²

(3). Area of the trapezium = [tex]\frac{1}{2}(b_1+b_2)(h)[/tex] [Where [tex]b_1[/tex] and [tex]b_2[/tex] are the bases and h is the distance between the bases]

                                           = [tex]\frac{1}{2}[(7-3)+7](7)[/tex]

                                           = [tex]\frac{77}{2}[/tex]

                                           = 38.5 cm²

Total area of the given figure = 5.25 + 31.5 + 38.5

                                                 = 75.25 cm²

Use the explicit formula 8. = a + (n-1). d to find the 500th term of the
sequence below.
24, 31, 38, 45, 52, ...
A 3545
B. 3517
C. 3524
D. 3493

Answers

Answer:

The 500th term is 3,517

Step-by-step explanation:

Here in this question, we are given an explicit formula to calculate the 500th term of the sequence

The formula to use is ;

a + (n-1)d

where a refers to the first term which is 24 in this case, while d is the common difference which is the difference between success terms and that is 52-45 = 45-38 = 7 and finally n is 500

Now we make a substitution into the formula and we have

24 + (500-1)7

= 24 + (499)7

= 24 + 3493 = 3,517

9 is subtracted from 3 times the sum of 4 and 2​

Answers

Answer:

9

Step-by-step explanation:

3 times the sum of 4 and 2 = 3*(4+2)

                                            = 3 * 6

                                           = 18

18 - 9 = 9

Solve by factoring 25x^2+5x-12=0

Answers

Answer:

x = -4/5 and x = 3/5.

Step-by-step explanation:

The coefficient of x^2 is 25, which is 5 * 5. 5 * -3 = -15, and 5 * 4 = 20. 20 - 15 = 5.

So...

25x^2 + 5x - 12 = 0

(5x + 4)(5x - 3) = 0

5x + 4 = 0

5x = -4

x = -4/5

5x - 3 = 0

5x = 3

x = 3/5

So, x = -4/5 and x = 3/5.

Hope this helps!

What is the name of the method for drawing a trend line for the data in a scatterplot in which an oval is drawn around all the points in the scatterplot except the outliers?


a.the oval method

b.the divide-center method

c.the area method

d.the regression calculator method


ty if you answer! :3

Answers

Answer:

c.the area method

Step-by-step explanation:

A scatterplot is a plotting of data that represents the relationship between the two variables that should be numerical in nature. The data points i.e to be shown in a horizontal and vertical axis represent that how much one variable affected by another variable.

In the area method, we plot a data and then draw a shape which can be in oval but it does not include the outliers but the other methods like oval method, divide center method, regression calculator includes the outliers

Therefore the option c is correct

Answer:

c.the area method

Step-by-step explanation:

c.the area method c.the area method c.the area method c.the area methodc.the area methodc.the area methodc.the area method c.the area method c.the area method c.the area method   c.the area method  c.the area method

Please find out the answer and I will mark your answer as the brain test with a five-star rating and a thank you. But only if the answer will be proper and neat...

Answers

Answer:

Below

Step-by-step explanation:

Let x be that missing number

One third of it is x/3

One-ninth of it is x/9

Multiply x/3 and x/9

● (x/3)*(x/9) = (x^2/27)

● (x^2/27) = 108

Multiply both sides by 27

● (x^2/27)*27 = 108*27

● x^2 = 2916

● x = √(2,916) or x = -√(2,916)

● x = 54 or x = -54

So there are two possibilities 54 and -54.

a1/3×1/9=!08

if you multiply you should get 1/27a=108

in order to let a alone multiply both sides by 27

and now your a which is unknown will equal 2916.

The table below shows data from a survey about the amount of time students spend doing homework each week. The students were in either college or high school:


High Low Q1 Q3 IQR Median Mean σ
College 20 6 8 18 10 14 13.3 5.2
High School 20 3 5.5 16 10.5 11 11 5.4


Which of the choices below best describes how to measure the spread of these data?
(Hint: Use the minimum and maximum values to check for outliers.)
Both spreads are best described by the IQR.
Both spreads are best described by the standard deviation.
The college spread is best described by the IQR. The high school spread is best described by the standard deviation.
The college spread is best described by the standard deviation. The high school spread is best described by the IQR.

Answers

Answer:

The correct option is;

Both spreads are best described by the standard deviation

Step-by-step explanation:

The given information are;

,                                    College                       High School

High,                              20                               20

Low,                                6                                 3

Q₁,                                   8                                 5.5

Q₃,                                  18                                16

IQR,                                 10                                10.5

Median,                           14                                11

Mean,                              13.3                             11

σ,                                      5.2                             5.4

Checking for outliers, we have

College

Q₁ - 1.5×IQR gives 8 - 1.5×10 = -7

Q₃ + 1.5×IQR gives 18 + 1.5×10 = 33

For high school

Q₁ - 1.5×IQR gives 5.5 - 1.5×10.5 = -10.25

Q₃ + 1.5×IQR gives 16 + 1.5×10.5 = 31.75

Therefore, there are no outliers and the data is representative of the population

From the data, for the college students, it is observed that the difference between the mean, 13.3 and Q₁, 8, and between Q₃, 18 and the mean,13.3 is approximately the standard deviation, σ, 5.2

The difference between the low and the high is also approximately 3 standard deviations

Therefore the college spread is best described by the standard deviation

Similarly for the high school students, the IQR is approximately two standard deviations, the  difference between the mean, 11 and Q₁, 5.5, and between Q₃, 16 and the mean,11 is approximately the standard deviation, σ, 5.4

Therefore the high school spread is also best described by the standard deviation.

Answer:

Both spreads are best described by the standard deviation

Step-by-step explanation:

Instructions: Find the measure of the indicated angle to the
nearest degree

Answers

Answer:

? = 33

Step-by-step explanation:

Since this is a right triangle, we can use trig functions

tan ? = opp / adj

tan ? = 13/20

Take the inverse tan of each side

tan ^-1 tan ? = tan ^-1 ( 13/20)

? = 33.02386756

To the nearest degree

? = 33

Answer:

33.

Step-by-step explanation:

inverse tan (13/20) = 33.023867579302

Factorize: 14x^6-45x^3y^3-14y^6

Answers

Answer:

(7x^3+2y^3)(2x^3−7y^3)

Use multiplication to solve the proportion.
9/5 = z/20

Answers

Answer:

36

Step-by-step explanation:

9/5 = z/20

First, we have to divide what we know

9/5 = 1.8

1.8 = z/20

Next, we have to multiply both sides of the equation by 20 to cancel out the division sign

1.8•20 = z/20•20

36 = z

Other Questions
The diversity committee at State U. is a long-standing committee with a stable membership. During the first meeting of the year, Sam, a relatively new member of the group, asks, "What are the plans for fall orientation?" Given that the group has a high-context culture, which of the following is the most likely response to Sam's question?a) We will have a special meeting at the end of the month to brainstorm ideas. We will appoint a subcommittee to draw up a schedule and deadlines for tasks, and proceed from that schedule.b) We will probably do the same thing we did last year.c) We will need to consult with the students who will be involved to get their input before we proceed. Then we can work on making a schedule and setting deadlines.d) That is the next thing on our agenda. Let's get busy deciding on a schedule, activities, and deadlines. Can someone help me with this one too John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 .