……..Help…………please……..thanks

..Helpplease..thanks

Answers

Answer 1
Hey this is your or my or whatever this is the other account because that one got banned cuz these kids be doing too much

Related Questions

HELLHELEPEGELLHELLPPPPPPPPP help please

If an acorn falls off a tree, is it living or non-living??

Answers

Answer: living

Acorns are still alive even off the tree and eventually grow into plants in the right conditions.

Answer:

Acorns are alive. Acorns live and breathe. Since they have no teeth and claws, acorns defend themselves with have chemicals called tannins. Because acorns decompose slowly, some gardeners compost them separately from other materials that break down more rapidly. Others grind them before composting them, as this speeds up decomposition.

therefore they are still living

Explanation:

brainliest?

What would happen if there is an obstruction in the vas deferens?​

Answers

A transfer of sperm to a female

A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.
A) M. bicolor and M. parma are in the same subspecies category. Eliminate
B) M. agilis and M. eugenii share the most recent common ancestor.
C) T. thetis and P. xanthpus share the most characteristics in common.
D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species.
E) M. agilis and M. eugenii share the greatest number of taxa levels than other species.

Answers

Answer: B and E

Explanation: USATESTPREP

Which of the following contain stem cells that produce most types of blood cells?
Bone Marrow
O Muscle cells
O Bile
O Plasma

Answers

Bone marrow produces many types of white blood cells.

At the core of the differences between gender and sex is the chromosomal information transmitted at the moment a child is conceived. An "XY" chromosome generally means A) a heterosexual embryo B) a male embryo C) a hermaphrodite embryo OD) a female embryo​

Answers

Answer:

B) male embryo

Explanation:

Tell me if you think caecilians are amphibians, reptiles, or fish.

Answers

Answer:

Amphibians

Explanation:

Someone please help me !

Answers

Answer:

A

Explanation:

A becouse planets do move and the sun move around eachother.

Rylee saw a cell under a microscope and drew what she saw. This cell is classified as —

Answers

Answer:

Well I need more information to answer that question.

Explanation:

Explanation:

can I have a picture of the question please


5. Explain the process through which natural selection can lead to a new species of organism.

Answers

Answer:

Through this process of natural selection, favorable traits are transmitted through generations. Natural selection can lead to specistion, where one species gives rise to a new and distincly different species.

need help, will mark brainliest! plsss.
Which of the following is *not* a physiological mechanism regulated by timing?

Circadian rhythms in eukaryotes
Hibernation of animals during winter
Photoperiodism to direct the flowering of plants- i think its this one
Viral reproduction in a host cell

Answers

Hello, I Am BrotherEye

Answer: Physiological mechanisms explain any health-related events or outcomes. Physiological mechanisms can be altered voluntarily. For example, exercise causes alteration in the cardiac physiology of resting state. ... Multiple physiological mechanisms are responsible for survival of an individual.

Explanation:

It Is Simple Find The Answer Choice That Is The Opposite Of The One Above

In the 1960s, homeostatic regulatory mechanisms in physiology began to be used to describe what normally happens to the value of the regulated variable over time. The body does not possess a physiological sensor for detecting these

I hope that this helps

What does "reliability" mean in these sentences?

Answers

Answer:

The first one is correct

Answer: The first one, the quality of being able to be trusted.

Don't really know how to explain but being reliable is being trustworthy and responsible.

Which of the following is an example of cross contamination? *
1 point
cutting a tomato and lettuce on the same cutting board
cutting chicken and a tomato on the same cutting board
washing the cutting board with hot water and soap before cutting each ingredient

Answers

Cutting chicken and tomato on the same cutting board

Put the following in order describing the process of using geothermal energy to create energy.
= Heat is collected from the Earth
= Steam turns a turbine.
= Generators produce electricity.
= Heat is used to change water into steam.

Answers

Answer:

1. heat is collected from the earth

2. heat is used to change water into steam

3. steams turns a turbine

4. generators produce electricity

Explanation:

High blood pressure is a common and dangerous condition affecting about 75 million people in the United States. It is known as the "silent killer" because many people don't know they have it. This contributes to the disease being the second leading cause of death of Americans.

Which of the following lifestyles would increase the risk of high blood pressure?



Group of answer choices:

Living a calm sedentary lifestyle on an island that is hit by an occasional hurricane.

Losing weight after childbirth.

Attending water aerobics class 4 times a year.

Eating meals that include fruits, vegetables and grains.

Answers

Answer:

losing weight after childbirth

Explanation:

This contributes to the disease being the second leading cause of death of Americans. Losing weight after childbirth.

What can high blood pressure cause?

Factors that can lead to high blood pressure have: A diet high in salt, fat, and/or cholesterol.

Chronic diseases such as kidney and hormone problems, diabetes, and high cholesterol.

Family background, quite if your parents or other close relatives have high blood pressure.

Thus, option "A" is correct,  Losing weight after childbirth.

To learn more about childbirth click here:

https://brainly.com/question/16013075

#SPJ2

An organ that makes and secretes hormones is called a
1] lung
2]gland
3]pancreas
4]thyroid

Answers

Answer: 2]gland brainliest?

Explanation:

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Answers

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Which technique will researchers studying the inheritance patterns of various disorders most likely use? A. CLADOGRAM, B. DNA FINGERPRINTING, C. GEL ELECTROPHORESIS, D. CHROMOSOMAL ANALYSIS

Answers

Answer:

Chromosomal Analysis

Explanation:

Most of the options are pretty superficial but chromosomal analysis goes in depth therefore you'll get more results and find what could potentially be wrong.

During fertilization, sperm cells will either contain an x or a y chromosome in addition to 22 other chromosomes, totaling______

Answers

The answer is A because

There are three species of birds on an island. Bird A has a heavy bill for eating seeds.
Bird B has a pointed bill for eating insects. Bird C has a sharp bill for eating both insects
and seeds. If all insects on the island suddenly disappeared, which bird or birds would
be the LEAST affected?



Please help

Answers

Answer:

A and C would least be affected

Explanation:

because a doesn't live off of insects and see if insects do disappear it still has seed stuff all back on

Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

What is the survival of the fittest?

This theory suggests that the fittest organisms survive in the environment and reproduce.

The fittest organisms have most of the required traits to survive. Bird A eats the seeds, Bird -B eats the insects, and bird C eats both seeds and insects,

Therefore, Bird A will be least affected if all insects on the island suddenly disappeared because Bird A does not depend on the insects.

Learn more about survival of the fittest:

https://brainly.com/question/1226176

How about decreasing the amount of water in blood affect blood pressure

Answers

Answer:

When you're very dehydrated, your blood volume can decrease, leading to a drop in blood pressure. When blood pressure drops too low, your organs won't receive the oxygen and nutrients they need. You could potentially go into shock.

A group of students wants to study the structures of animals in the desert. One question they should ask is-
How long do the animals live?
Can you buy the animals in pet stores?
How do the animals satisfy their need for water?
How many offspring do the animals have?

Answers

Answer:

Jdjdjdj

Explanation:

Animals survive in deserts by living underground or resting in burrows during the heat of the day. Some creatures get the moisture they need from their food, so they don't need to drink much water, if any. Others live along the edges of deserts, where there are more plants and shelter.

Even though deserts don't get much rain, the desert is a habitat for some plants and animals. Each species has adapted to be able to live in a range of temperatures and without much water. ... Animals that live in deserts include lizards, geckos, toads, jackrabbits, camels, snakes, spiders and meerkats.

Essay Question: Which two species are more closely related?

Answers

Answer:

mannimals;humens and animals

Explanation:

PLZ HELP ME!!!!
2. What happens to sedimentary rocks on Earth’s surface?

Answers

Answer:

Sedimentary rock can change into metamorphic rock or into igneous rock. ... On Earth's surface, wind and water can break rock into pieces. They can also carry rock pieces to another place. Usually, the rock pieces, called sediments, drop from the wind or water to make a layer

Explanation:

Answer:

Sedimentary rocks are formed on or near the Earth's surface, in contrast to metamorphic and igneous rocks, which are formed deep within the Earth. ... Erosion and weathering transform boulders and even mountains into sediments, such as sand or mud. Dissolution is a form of weathering—chemical weathering.

Explanation:

Hello! could someone please do a 4 sentence quark poem

Answers

Answer:

Quark is a character in the television series Star Trek: Deep Space Nine.

Quark developed a few strong friendships during his stay on Deep Space Nine.

The Ferengi have business deals throughout the galaxy; Quark is no different.

For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.

Explanation:

Which of the following best predicts and justifies how the proportion of the Tibetan population with big blood vessels living in the mountains will change over the next 1,000 years (assuming conditions remain stable)?

Question 2 options:

I predict that the proportion of individuals with big blood vessels living in the mountains will decrease because there is a variation in blood vessel size and those with the smaller blood vessels can store more red blood cells than larger vessels, so more oxygen can be moved to the body cells. Therefore, they have a better chance of surviving and passing this trait on to their offspring.


I predict that the proportion of individuals with big blood vessels living in the mountains will stay the same because there is a variation in blood vessel size and that variation will remain in a population. The is what is so cool about humans, we are all so unique.


I predict that the proportion of individuals with big blood vessels living in the mountains will increase because there is a variation in blood vessel size and those with the bigger blood vessels can deliver more oxygen to the body cells and therefore have a better chance of surviving and passing this trait on to their offspring.


I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Answers

Answer:

Over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the number of red blood cells it makes, not its blood vessels.

Explanation:

Evolution is the change in the characteristics of a species over several generations and relies on the process of natural selection

What is blood vessels?

The blood vessels are the components of the circulatory system that transport blood throughout the human body.

I predict that over 1,000 years, the proportion of individuals with big blood vessels living in the mountains will not change because a change can’t happen to an individual, an individual can only increase the amount of red blood cells it makes, not its blood vessels.

Hence, option D is correct.

Learn more about blood vessels here:

https://brainly.com/question/4601677

#SPJ2

If you find a fossil in two different locations and it has featured in common with dinosaurs and modern birds, how does this support the evolutionary theory?

a) the two species must not be related
b) looking at the fossils, they show similarities both physically and in their DNA that don't appear to change much over time
c) dinosaurs must have evolved from mammals because their bones are similar in size rather than birds
d) the land must have been together at one point where these two species interbred to share a common ancestor

Answers

Answer: D

Explanation: the continents wee once connected. It was known as Pangea

What are the goals of binomial nomenclature and systematics?

Answers

Answer:

The goal of systematics is to organize living things into groups that have biological meaning. the science of naming and grouping organisms.

Explanation:

Which of the following best describes the material that makes up the Earth's asthenosphere
The Layers of The Earth
A. Liquid magma
B. A rigid solid
C. A soft solid that is able to flow (convection currents)


PLEASE HELP

Answers

Hi you have to be in here in a you know what you do it for you to do that you can help you get your money I will send it

Earth's crust is a thin layer made of
a rock
b metal
c liquid metal
d water

Answers

B!!!!!!!!!!!!!!!!!!!

Answer:

a

Explanation:

The fan illustrated here plugs into the wall and blows air to make a room cool.




Which of the following best explains how it works?
A: It reduces heat by producing sound energy.

B: It gets chemical energy from gases in the air.

C: It transform electrical energy into the energy of motion.

D: It spins, sending heat and light energy through its wires.

Answers

Answer:

The only logical answer is C, the other ones don't make sense

Explanation:

I hope this helps! :)

Other Questions
Assuming you have been assigned to speak on the topic of "Expanding the Use of Technology in the Classroom" (or a topic of your choosing), what are some specific things you will do to identify with your audience? What are some areas of selective exposure you should anticipate for this topic? What are some specific things you can do to appeal to your audience? which statement best describes the connection that Aristotle identifies between friendship and virtue. Before you read the text, write a prediction about the main idea using metacognition to choose the best reading strategy to help you do this. Write the strategy you chose. Renting an apartment after college is a good idea because it can:A. Establish Credit B. Establish residency C. Teach Payment Consistency D. All of the Above Indicate true or false for each statement by writing the words true or false in the blanks. Certain plants contain compounds similar to ecdysone which serve as a defense against insects. Juvenile hormone levels are high in insect larvae, but must decrease in order for metamorphosis to occur. Chemicals similar to ecdysone and juvenile hormone are widely used commercially to control insect pests PLEASE HELP ME!!! THANK YOU SO MUCH! How many anime have you watched and name 10 of them if you can :D How has the Bill of Rights created a more perfect Union? Remove the brackets using the distributive law for the following: -9(a + 4) Please help me X*1+ x/1Pick one of thesex12x1+x The weight of the elephant is 4500 kg, and the area of the sole of one of its legs is 1700 cm2. Calculate the pressure of the elephant on the ground. How is the nazi party platform an example of nationalism? Mike drives his car 60 km in 55 minutes. What is theaverage speed? Which of the following is a group of tissues that work together to carry out afunction?A. Body systemB. OrgansC. TissuesD. Organism example of factor isolating question pls help 1755.97809915 round to the nearest cent Driving Your brother and sister took turns driving on a 635-mile trip that took 11 hours to complete. Your brother drove at a constant speed of 60 miles per hour and your sister drove at a constant speed of 55 miles per hour. Let x be the number of miles your brother drove and let y be the number of miles your sister drove. Solve the linear system x + y = 11 and 60x + 55y = 635 to find the number of miles each of your siblings drove. Show your work. A_________________group is one that is not controlled or influenced by a group, such as a political party.a. Non-partisanb. Moderatec. Constituentd. Third partyPlease select the best answer from the choices providedABCD A clothing salesperson earns a 10% commission on a $65sale. How much is the commission? Refer to the diagram below. If mFGJ=21, find mGCD.