Help plzzzz!!!!!!!???!!!!!

Help Plzzzz!!!!!!!???!!!!!

Answers

Answer 1
The answer is A.
As the population increases, so will deforestation. With deforestation, habitats will be destroyed leading to a decrease.

Related Questions

6. Why does the study of cell membranes lead to a better understanding of cell function?
a. All cell functions occur in the cell membrane.
b. All energy transfers occur at the cell membrane.
C. All cell membranes contain the information for making proteins.
d. All materials needed for cell functions must pass through the cell membrane.

Answers

Answer: d. All materials needed for cell functions must pass through the cell membrane. brainliest?

Explanation:

what is the term for the process of cell division that results in the formation of gametes ?​

Answers

Answer:

meiosis

Explanation:

Please Help I will mark bRAINLIEST

Answers

Answer:

d

Explanation:

In particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

Question C. please... :) And NO FILES I WILL REPORT YOU!

Answers

The best way to describe it would be “the pattern of the graph is constantly changing as it goes thru series of increased and decrease through out the years”

I need URGENT help with 16 through 18 pls!!!

Answers

Answer:

16. Directional Selection

17. Disruptive Selection

18. Stabilizing Selection

19. Natural Selection

20. Adaptation

Explanation:

In population genetics, directional selection/positive selection is a mode of natural selection in which an extreme phenotype is favored over other phenotypes.

Disruptive Selection would show phenotypes (individuals with groups of traits) of both extremes but have very few individuals in the middle.

Stabilizing Selection. Occurs when individuals at the extremes of the range of characteristic are selected against. This means that the "average" individuals are selected for.

Help please :) thank u

Answers

Answer:

!! neither mechanical nor chemical digestion

A moon has less mass than a star and more mass than a planet it orbits.
•True
•False

Answers

It is false bc the mass of moon is less than 1/2 of earth, and earth is tinier than ANY STAR

Somebody please help? Thanks​

Answers

Answer:

None

Explanation:

because y is recessive and it needs to be yy to be green so Yy wouldn't wrok

The answer is none


...

Create a food chain with a producer and 3 consumers.

Answers

Answer: dandelion is consumed by bees, grasshoppers, and butterflies.

Answer:

primary consumers, secondary consumers, tertiary consumers.

Explanation:

Hope this helps

Consider the four organisms you see here. Each represents a specific kingdom. They all exhibit the characteristics of life. Think about
their life cycles. Compare and contrast the life cycles of the four. How do they differ?
es )

Answers

Answer:

Please where's the image of the question

Answer:

B

Explanation:

Both the animal and the plant exhibit stages of growth during their lifetimes. They have what mightbe described as a mature stage. The other two, protist and bacteria do not.

An eastern screech owl, a carnivore, might compete with which organism most intensely for resources?
A. hawk (secondary consumer)
B. mountain lion (secondary consumer)
C. wren (primary consumer)
D. mouse (primary consumer)

NO LINKS PLEASE

Answers

i think it would be A

What does the phrase of sunshine and of song mean in the poem?
A.
memories
B.
weather
C.
happiness
D.
singing

Answers

Answer:

a

Explanation:

What are the characteristics of vitamins and minerals? (Select 3)
A.They are gained by the body by eating.
B.They are produced inside the body.
C.They help the body get energy.
D.They help your immune system fight disease.

Answers

Answer:

.

Explanation:

Answer: A, C, D. Hope this helps:

Explanation: Open Photo ;)

Please help!! Any word is greatly appreciated :) thanks <3

Answers

Stem anatomy

WORD DEFINITION

Monocot Plant where Xylem and Phloem are arranged in bundled scatters

Node Location on the stem where leaves and buds are attached

Corm A bulb-shaped specialized stem that is made of solid stem and had no leaves

Stolon Specialized stem that is usually horizontal and above the soil

Specialized Stems Bulbs, Corm, Rhizomes, and Tubers

Apical Meristem Actively growing tip found inside a terminal or lateral bud

Terminal Bud End of stem or branch

Xylem Cells in the stem where they carry UP water and minerals

Lenticel A mark on the outside of the stem that allows gas to be exchanged

Lateral Bud Bud that is found on the side of the branch

Sapwood Part of woody stem that actively conducts water and dissolved minerals

Bulb Specialized stem made of short, flat stems and contains many fleshy leaves

Dicot Plant where it's Xylem and Phloem are arranged in a circle

Inter Node Area on the stem that lies between 2 leaves/buds

Leaf Scar Scar left when a leaf falls off

Bud Scale Scar Area in the stem that shows the location of last years bud

Phloem Tube-shaped cells that carry DOWN water and minerals

Tuber Specialized stem that's tip is swollen with stored food

Rhizome A specialized stem that is thick and runs horizontally under the soil

Bud Scale Small protective structure that can be seen on the outside of a bud

Vascular Cambium Area inside stem where new Xylem and Phloem are made

Explanation:

hope this here helps you

I attached the words in order down below

Write your explanation of the role of genetics in Natural and Artificial Selection. Write on how environmental factors affect the survival based on Natural and Artificial Selection.

Answers

Natural selection is the survival of the fittest. Basically the organisms that best suit the environment they’re in will survive, and the less suited will pass. Artificial selection is when humans intervene and breed plants and animals to have desired traits. Like if one turtle has a longer neck than the other, and the plants are really tall in an area, people might selectively breed them so less turtles are dying of hunger.

is the following truth or false? lava flows on the moon sometimes overlap highlands, showing that maria deposits are younger than highlands

Answers

Answer:

false

Explanation:

The different forms of the beef cattle color gene are called_

Answers

The answer is right there click on it 271 the beef is colored red

The different forms of the beef cattle color gene are called "alleles"

What are alleles?

Alleles are alternative versions of a gene that arise from mutations and are located at the same position on a chromosome.

In the case of beef cattle, the color of the animal is determined by the interaction of multiple genes, including the color gene. The color gene can have different alleles that influence the color of the animal's coat. For example, one allele may result in a black coat color, while another allele may result in a red coat color.

The combination of alleles that an animal inherits from its parents determines its genotype, which in turn determines its phenotype or observed traits. Therefore, the different alleles of the beef cattle color gene can result in different coat colors, patterns, and markings in the cattle population.

Learn more about alleles, here:

https://brainly.com/question/14104138

#SPJ6

please help asap

Summarize how atmospheric pollution affects living organisms and the environment by completing the chart below:

Answers

Answer:

humans- exposes them to the ultra-violet rays of the sun causing cancer

animals- causes the pollution of gases found within the atmosphere

plants- polluted atmosphere contains poisonous gases that pour down as acid rains causing soil pollution and depletion on nutrients for plants

Environment- causes global warming

which type of specialized cells would be found in an animal’s neuvous system?

Answers

Animal nerve cells are specialized cells called neurons. Depending upon function, these cells can be divided into sensory neurons, interneurons, and motor neurons.

The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.

What is the nervous system?

The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.

Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.

Therefore, the correct option is D. Cells that can transmit signals around the body.

To learn more about the nervous system, refer to the link:

https://brainly.com/question/29355295

#SPJ2

The question is incomplete. Your most probably complete question is given below:

Cells that transport oxygen are found in the blood.

Cells that secrete hormones to trigger cellular responses.

Cells secrete enzymes to break down food.

Cells that can transmit signals around the body.

The weight of astronaut on the moon will be
A) Less because the moon has less mass
B) Less because the moon has more mass
C) More because the moon has less mass
D) More because the moon has more mass

Answers

Answer:

A

Explanation:

The gravity of a body increases with its size. The moon is smaller than the Earth, so an astronaut will weigh less on the moon than they will on Earth. Good luck ^^

Explanation:

A because im big brain

Why is the success of a mutation dependent on environmental conditions?


PLEASE HELP QUICK!!!

Answers

the mutation can only be passed down in the environment is in the favor of the gene (natural selection)

ex. dark haired mice only surviving on dark lava rock while the white mice on the dark lava rock are getting killed.

what are the three age categories labels between childhood and adulthood

Answers

Answer: Early adolescence, middle adolescence, and late adolescence.

brainliest or a thank you please :)) <33

what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer:

AUGGCCUACGGUCUAGUUUAG

refers to the attitudes, behavior, and activities that are socially defined as appropriate for each sex and are learned through the socialization process. OA) Sexual role B) Gender identity OC) Gender role D) Sexual identity​

Answers

Answer:

Gender Role

Explanation:

How people already see how people should act. Example- Be a man.

Answer:

b. sex

Explanation:

edge 2021

In fruit flies, the allele for normal-sized wings (W) is dominant to the allele for small wings (w). A fly that has normal wings breeds with a fly that has small wings. Several offspring have small wings, and others have normal wings.

A. What are the genotypes of the 2 parental flies?
Normal wings __________
small wings __________

B. Two flies with small wings produce offspring. What type of wings will the offspring
have? Draw a punnett square to support your answer.

C. A short winged fly can be described -using words as what?

D. What type of inheritance is this called?

Answers

Answer:

A. Normal Wings= Ww, Small Wings=ww

B. All offspring will have short wings because short wings trait is recessive.

w. w

______

w| ww |ww|

————-

w|ww |ww |

______

Explanation:

Why does the ability to lay 1,000 to 5,000 eggs increase the fitness of the species L. clamitans clamitans?


It increases the probability that moving water will promote gene flow from one population to another.

It increases the chance of the recombination of alleles, leading to genetic drift in the population.

It increases opportunities for offspring to compete for limited resources.

It increases the probability that some offspring will survive long enough to reproduce.

Answers

Answer:

increases opportunities for offspring to compete for limited resources.

correct answer gets brainiest. and i’m telling u. if u guess or leave a link, ur getting reported and that’s not a threat

Answers

The correct answer is D

Plz HELP!! where does respiration, the process of releasing energy from combination of oxygen and glucose, occur? A. Cells B. Bronchi. C. Pharynx. D. Nose

Answers

Answer:

 A

Explanation:

     

Ms. B has 32 students assigned to her class. Her room only holds 28 students. The other 4 need to go to the officer for a schedule change-

Northern pike (a fish) feed on another fish, the yellow perch. An increase in the yellow perch population causes an increase in the pike population-

The BP oil spill in the Gulf of Mexico has harmed many aquatic organisms that live in the Gulf region-

A new strain of influenza breaks out in New York City-

The population of rabbits and a population of deer are both feeding off the same plants in the same area-

Hurricane Katrina forced thousands of people to leave New Orleans-

65 million years ago, a large asteroid collided with the Earth. As a result, large amounts of ash were ejected into Earth's atmosphere.

Answer choices: Density Dependent
Density Independent

Answers

Answer:

Density Dependent

Explanation:

i think hope it helps

What is the process of the digestive system?

Answers

Answer:

In terms of processes: ingestion, motility, mechanical digestion, chemical digestion, absorption, and defecation.

In terms of pathway: Mouth, throat, esophagus, stomach, small intestine, large intestine, rectum, and finally the anus.

Other Questions
In conclusion more people should eat at home because? Find the value of x solving steps 1. It is formed when one substance is dissolved in another substance. 2. It contains solute and solvent. 3. Smoke is what kind of mixtures? 4. It is used in making pottery.5. They just settle out when left undisturbed. 6. A mixture of oil and water. 7. Substances that do not mix when combined 8. It is used in dialysis. 9. Alloy and steel are examples of what mixture? 10. Particles are no longer identified when mixed. The Federalists believed the United States needed Answer this for 50 points heyyyyyyyyyy kinda need help asap sooooooo plz :) Solve this plz ill give your brainly How can you show that a given number is the solution of an equation?Substitute the value into the equation for the variable and simplify. A true statement will result.Substitute a similar value into the equation for the variable and simplify. The resulting false statement shows the original value is true.Substitute the value 0 into the equation for the variable and simplify. If the result is 1=1, then the original value is the answer.Solve the equation for the variable. The solution will always produce a true statement. VCalculate the length of Mary's trip.10 miles14 miles24 miles28 miles how long does it take to recover from penile enlargement surgery I need some help with 12 please What is the domain and range of the functiongraphed below? How does the U.S government protect private property?(ECONOMIC) how many complex roots does the polynomial equation have? 5x34x+1=0 Please help, I need this in by today Who was the most influential representative at the conference ( the congress of vienna) write the solubility equilibrium for the slightly soluble salt caf2. Which of the given is the set of zeroes of the polynomial p(x)=2x3+x2-5x+2 -3x-2y-3z=5x+2y-z=-19-2x+y-2z=1 Use the point-slope formula to write an equation of the line that passes through (-5, -4) and (3, -1).Write the answer in slope-intercept form (if possible).