help meeeeee please ​

Help Meeeeee Please

Answers

Answer 1

If it's a rectangle:

perimeter = 2F+10g

Area=g(4F+4g)

Step-by-step explanation:

Perimeter = 2×(l+b)

Area= l×b


Related Questions

Write a sentence about anything you want using the ratio 4: 2. (Hint Start with the words "For every")

Answers

Answer:

For every four cookies, there are two glasses of milk.

OR

For every four scoops of ice cream, there are two plates.

Step-by-step explanation:

Anything works really, just make sure it make sense.

Hope this helps :-)

Please Help!!!!

∠A and ​∠B​ are vertical angles with m∠A=x and m∠B=4x−30.

What is m∠A?

Answers

Answer:

m<A=10

Step-by-step explanation:

I left the image below to show my work of how i got to that answer. I hope this helps!

We know vertical angles have same measure!

Thus!

A = B

=> X = 4X -30

=> 3X = 30

=> X = 10

Thus measure of angle A is 10°

HELPP!!
if f(x)= 5x - 12 what is f(-4)

Answers

Answer:

-32

Step-by-step explanation

f(-4)= 5(-4) - 12

f(-4)= -20 -12

f(-4)= -32

What is the value of the following function when x = 0?
5
4
Q
NO
2
3
4
5
x
O y=-5
O y=-2
O y=-1
V=

Answers

Answer:

so I am not sure what fiction you are talking about but in order to solve you would substitute 0 in for x in the function. this would represent the y intercept.

Alan takes 3 minutes to draw a picture. Beatrice takes 4 minutes to draw a picture. If Alan and Beatrice start drawing pictures at the same time, how long will they draw before they can complete a picture at the same time?​

Answers

Answer:

12 minutes

Step-by-step explanation:

alan: 3, 6, 9, 12

beatrice: 4, 8, 12, 16

Both times meet at 12 minutes.

How many significant figures in 20340 ?

Answers

There are 4 significant figures in 20340.

There are 4. (2,0,3,4) the last 0 doesn’t count as a sig fig

Evaluate 3x-4 when x=7

Answers

Answer:

17

Step-by-step explanation:

We plag the var in first

3(7)-4

21-4

17

Answer:

17

Step-by-step explanation:

3(7) - 4

21 - 4

17

Hope this helps!

Each side of a square is lengthened by 2 inches. The area of this new, larger square is 64 square inches. Find the length of a side of the original square.

Answers

Answer:

48 is the answer

Step-by-step explanation:

we have to do like that

we have to subtract 64 by 16

because every side was increased

by 2 so we have to subtract and you

will get answer as 48

please follow me

Please help me answer this :)

Answers

Answer
A
Why?
He did not distribute 2/3 to the x

4 ten thousands 4 thousands x10

Answers

(10,000 x 4) (4,000 x 10)

Suppose 27 gallons of water came out of a pipe in 9 minutes.what was the rate in gallons per minute

Answers

Answer:

Rate = 56 gal / 7 min

         = 8 gal / min

Step-by-step explanation:

Hope this helps pls leave a heart c:

The rate is 3 gal/ minute

What is the image of (3, 6) when it is translated along the horizontal vector -2,0?

Answers

Answer:   (1,6)

The vector <-2,0> means we shift the input point two units to the left.

This is the same as writing the rule [tex](x,y) \to (x-2,y)[/tex]

Subtract 2 from the x coordinate. The y coordinate stays the same.

After the translation the point becomes P'(1, 6).

What is the difference between upward, downward, leftwards and rightwards translation?Upward translation : [k] units = When the upward translation take's place then, each point will have its y - coordinate shifted upwards by +k units.Downward translation : [k] units = When the downward translation will take place then, each point will have its y - coordinate shifted downwards by -k units.Leftward Translation : [k] units = When the leftward translation will take place then, each point will have its x - coordinate shifted by -k units to the left.Rightward Translation : [k] units = When the rightward translation will take place then, each point will have its x - coordinate shifted by +k units to the right

Given is a coordinate point (3, 6).

The horizontal vector is given by -

A = - 2i + 0j + 0k

A = - 2j

When the point is translated along the vector, then, we can write -

P(3, 6) → P'(3 - 2, 6) → P'(1, 6)

P'(1, 6)

Therefore, after the translation the point becomes P'(1, 6).

To solve more questions on Graph translations, visit the link below -

brainly.com/question/12802031

#SPJ2

The linear parent function is f(x)=

Answers

Answer:

let's see...

Step-by-step explanation:

The linear parent function is :

[tex]f(x) = a \: x + b[/tex]

Where a is the slope of the line and b is the width of the origin.

Answer:

f(x) = x

Step-by-step explanation:

Marsha gave the cashier $40 to pay for 3 pairs of socks and 1 shirt for 13.50. The cashier gave her $9.03 in change. Each pair of socks cost the same amount.

Answers

Answer:

5.82

Step-by-step explanation:

first I subtract 40 from 13.50 which gave me 26.50 . then i subtract 26.50 from 9.03 which gave me 17.47 then i divide 17.47 by 3 which gave me 5.8233333

PLEASE HELP IN BEING TIMED

Answers

Answer:

2 teams of 10

4 teams of 5

5 teams of 4

10 teams of 2

Hope this helps!

Answer:

A. 2 teams of 10

c. 4 tearms of 5

d. 5 teams of 4

F. 10 teams of 2

Step-by-step explanation:

Which inequality best represents the domain of the part shown

Answers

Answer:

there is no question upload it

Step-by-step explanation:

Answer:

so guess what I need some points so that's why I'm committed

What is the domain of the following relation: Is this relation a function? Why or
why not?
R: {(1, 2), (-3,5), (1, -2), (2, -3)}?

Answers

D={1,2,-3}
And it is not a function cuz two 1 x value has two picture in y value

Kenya has 2 hours to work a 100 problem math test at what rate must she work in order to finish in 2 hours A. 0.83 B. 1.23 C. 1.41 D. 1.35

Answers

Answer:

A 0.83

Step-by-step explanation:

2 Hrs = 120 Minutes

100 : 120 = 0.83 minutes per questions

Kenya must complete 0.83 questions per minute in order to finish the test in two hours.

What is a unitary method?

A unitary method is a mathematical way of obtaining the value of a single unit and then deriving any no. of given units by multiplying it with the single unit.

Given, Kenya has 2 hours to work on a 100 problem math test.

We know, 2 hours is equal to 120 minutes.

Therefore, The rate per minute at which she must complete one question in order to complete it in two hours is,

= (100/120).

= 0.83.

learn more about the unitary method here :

https://brainly.com/question/28276953

#SPJ6

Is PQRST a scaled copy of ABCDE

Answers

Answer: no

Step-by-step explanation:

Jake goes to the vampire School every 4 days and Werewolf School every 6 days. If he goes to both on October 3rd, on what date will he go to both again?

Answers

Answer:

October 15

Step-by-step explanation:

The LCM of 4 and 6 is 12. 12 days later is october 15.

grandpa has some cows and ducks in his farm. all in all there are 8 heads and 26 legs, how many cows and ducks are in there? solve this using factoring, finding multiples and divisibility rules

Answers

Answer:

5 cows  and 3 ducks

okay well there are 8 heads and each animal has a head meaning that there are a total of 8 organisms in total. Cows have 4 legs and ducks have 2. Lets say that c is cows and d is ducks. You would have the equations ...

c+d=8

4c+2d=26  

well d techniacally = 8-c, so plug in (8-c) for the value of d

4c+2(8-c)=26.      Distribute to get

4c+16-2c

and then add like terms. Soy ou would get

2c+16=26.

then just isolate the variable but subtracting 16 from both sides and dividing 2 on both sides. The answer you would get is that c=5 so there are 5 cows. Plug in 5 for c so you get 5+d=8 and tadaaaa you subtract 5 from both sides to get that there are 3 ducks.

hope this helps :)

How many ways are there to make change for $3? (Utilize all forms of US currency, such as Silver dollars, half dollars, quarters, nickels, & pennies.) Is there a specific formula to calculate this?

Answers

Answer:

300 pennies. 12 quarters. 6 half dollars. 3 silver dollars. 60 nickles. 30 dimes.

Step-by-step explanation:

Pennies have a value of .01 so we add that to equal 300. For three dollars we need 12 quarters. 300 divided by the value of the quarter which is .25 cents. We have six half dollars (we divide 300 by the value of the half dollar). We would need 3 silver dollars since each is worth a dollar each. We would need 30 dimes (300 divided by 10).  Finally, we would need 60 nickels (300/5 = 60).

I hope this helps. Feel free to ask any questions.

Check off all factors of the given number 9,301​

Answers

Answer:

1, 71, 131, and 9301.

Step-by-step explanation:

f(x) = 4/5 x - 2

Find f(3)



Answer is a fraction ​

Answers

Answer:

2/5

Step-by-step explanation:

f(x) = 4/5 x - 2

Let x=3

f(3) = 4/5 *3 - 2

     =12/5 -2

    =12/5 -10/5

    = 2/5

The answer would be 2/5 it’s like your minusing 2 from 4 and keeping the 5 the dominator and then u would have 2/5

When do we use = and when do we use ~
=​

Answers

When we use this = it means it is the exact
answer
When we use ≈ it means it is an estimated answer and not the exact answer Example 12.4684729572974729758328 ≈ 12



Brian has a huge barn, 32 chickens, 12 pigs, 8 horses, 6 cows, 16 ducks, and 10
goat

Answers

Answer:

what's the question

Step-by-step explanation:

Answer: So he has 84 animals was there a question to this or is Brian flexing his barn?

Step-by-step explanation:

Help please ASAP will mark brainliest!!!!

Answers

Answer:

43

Step-by-step explanation:

You purchase a burrito for $8.39 and a juice for $2.25. You pay for both items with a $10 bill and a $5 bill. Complete a verbal model for the problem. Then find how much change you receive.

Answers

Answer:

You will get $4.36 back.

Step-by-step explanation:

You have to total the cost of the food and drink.

8.39 + 2.25 = 10.64

You give your total money to the cashier to pay for your goods.

10 + 5 = 15

The cashier will give you the refund or change back.

15 - 10.64 = 4.36

Image attached below. Please help.

Answers

Answer:

B. (-infinity, 1)

Step-by-step explanation:

Remember that domain is left to right, and range is down to up.

Question asks to find where the domain is increasing

Increasing means when the line increases

look left, the line extends infinitely in the negative direction: -infinity

There is a discontinuity at 1, and then the line decreases. So that would be the second point

The interval at which the domain is increasing is

The quotient of a number and 3 minus two is at least -12.​

Answers

Step-by-step explanation:

The problem would translate to this:

[tex]\frac{x}{3} -2 \geq -12[/tex]

Then add 2 to both sides.

[tex]\frac{x}{3}\geq -10[/tex]

Then multiply both sides by 3.

[tex]x\geq -30[/tex]

Other Questions
Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. 275,000 plus 5.4 times 10 to the 5th power Whats a religion ??? Javier has a basket of oranges and apples. The number of oranges is 2 more than twice the number of apples in the basket. The difference of half the number of oranges and half the number of apples is 4.An equation created to find the number of apples Javier has in the basket will have What are all the correct equations factorizar por el motodo de aspas [tex]12x^2 = 3x + 2[/tex] Consider this expression. -3x2- 24x - 36 What expression is equivalent to the given expression? Read the poem. Then, select the correct answerexcerpt adapted fromI Wandered Lonely as a Cloudby William WordsworthI wandered lonely as a cloudThat floats on high o'er vales and hills,When all at once I saw a crowd,A host, of golden daffodils;Beside the lake, beneath the trees,Fluttering and dancing in the breeze,Continuous as the stars that shineAnd twinkle on the milky way.They stretched in never-ending lineAlong the margin of a bayTen thousand sawl at a glance,Tossing their heads in sprightly dance.For oft, when on my couch I lieIn vacant or in pensive moodThey upon that inward eyeWhich is the bliss of solitude:And then my heart with pleasure fills,And dances with the daffodils.Which word best describes the author's tone?Aadmiring.desperateOC somberOD playful \How does the allusion to Ham affect the meaning of the text?It emphasizes Douglass's desire to be free.It allows Douglass to discredit using the Bible to justify slavery.It highlights the similarities between enslaved people and those who enslave them.It compares slavery in the modern world to slavery in Biblical times. Write the definition of a function named count that reads all the strings remaining to be read in standard input and returns their count (that is, how many there are) So if the input was: hooligan sausage economy ruin palatialthe function would return 5 because there are 5 strings there. PLSS HELPP What is the value of x in this equation?4x 2(2x 2) = 2(2x 4) The company's profit will be exactly $0 if it makes and sells jackets. The company will make a profit if it makes and sells jackets, but will not make a profit if it makes and sells jackets