Help me please and sorry about the points it doesn’t let me do more than that

Help Me Please And Sorry About The Points It Doesnt Let Me Do More Than That

Answers

Answer 1
i think the slope would be 1.5
explanation: i’m not sure but rise/run,
y2-y1/x2-x1
(1,1.5) (4,6)
6-1.5/4-1=4.5/3=1.5

Related Questions

Ayden rents skates at the skate park for
$1.25. He also spends $1.75 on snacks
and a drink each time he goes. If Ayden
has $20, which expression shows how
much money Ayden will have left over if
he visits the skate park a times?
A $20 + [($1.25 + $1.75) X a]
B $20 + ($1.25 + $1.75 X a)
c $20 - [($125 + $1.75) X aj
D $20- ($1.25 + $1.75 X a)

Answers

Answer:

C

Step-by-step explanation:

Figure 1 is dilated to get Figure 2.

What is the scale factor?

Answers

Answer:

2/3

Step-by-step explanation:

6/9 in simplest form is 2/3. That's the scale factor :)

Profit, P(x), is the difference between revenue, R(x), and cost, C(x), so P(x) = R(x) - C(x). Which expression represents P(x), if R(x) = 2x^4 – 3x^3 + 2x – 1 and C(x) = x^4 – x^2 + 2x + 3?

Answers

Answer:

x^4-3x^3+x^2-4

Step-by-step explanation:

Given the following functions

R(x) = 2x^4 – 3x^3 + 2x – 1 and

C(x) = x^4 – x^2 + 2x + 3

We are to find the profit function P(x)

P(x) = R(x) - C(x)

P(x) = 2x^4 – 3x^3 + 2x – 1 - ( x^4 – x^2 + 2x + 3)

P(x) = 2x^4 – 3x^3 + 2x – 1 - x^4 + x^2 - 2x - 3

Collect the like terms

P(x) = 2x^4-x^4-3x^3+x^2+2x-2x-1-3

P(x) = x^4-3x^3+x^2+0-4

P(x) = x^4-3x^3+x^2-4

Hence the required profit function P(x) is x^4-3x^3+x^2-4

Answer:

x^4-3x^3+x^2-4

Step-by-step explanation:

Linear relation questions(someone please help I will give brainliest please)

Answers

Answer:

See below

Step-by-step explanation:

#1

Points given:

(4, -6), (-1, 4)

Find the slope using slope formula:

m = (y₂ - y₁)/(x₂ - x₁) = (4 - (-6))/(-1 - 4) = 10/-5 = -2#2

Equation of the line in slope-intercept form:

y = mx + b

Given:

slope, m = -3the y- intercept b = 11

The line is:

y = -3x + 11#3

The y-intercept is the intersection of the line with the y-axis:

b = -1 as per graph

To find the slope select two points and use the slope formula as shown above.

Points (0, -1) and (1, 1), the slope is:

m = (1 - (-1))/(1 - 0) = 2/1 = 2

The line is:

y = 2x - 1

pls help pls help!!!!! ok ty

Answers

Answer:

D

Step-by-step explanation:

Indepedent values basically means the x-values

Also sorry for last answer

What are the slope and the y-intercept of the linear function that is represented by the equation y - 9x-27?

Answers

Answer:

the slope and the y-intercept of the linear function that is represented by the equation y = 9 x minus 27? The slope is –2, and the y-intercept is 9.

Step-by-step explanation:

hope this helps

Please help me. I am pretty confused on this ​

Answers

Answer:

C

Step-by-step explanation:

16's square root is 4

the square root of 16 is 4

Solve the equation 2.2x=3

Answers

it would be 15/11 but the better answer it would be 1 4/11

Answer : The answer is 15/11 but you can simply this fraction which makes it to a decimal which would be 1.36 ( 36 is repeating )

Giving brainlist to whoever answers

Answers

Answer:

B I am 100% sure

Step-by-step explanation:

Which is the approximate measure of angle ACB?
31.0°
36.9°
53.1°
59.0°

Answers

Answer:

53.1

Step-by-step explanation:

i just took the test

Answer:

53.10

Step-by-step explanation:

Factor out the Greatest Common Factor (GCF): 36y - 16 ?

Answers

Answer: 4(9y-4)

Step-by-step explanation:

36y - 16

4 x 9 is 36

4(9 is just like 36y.

Solve for the surface area

Answers

Answer:

210.7

Step-by-step explanation:

7x8 (and multiply that by 3 for the 3 sides)

7x6.1 (times 2 for the 2 sides and divided by 2 because it is a triangle)

Bob flipped a coin and got "heads" 9 times in a row! What is the probability that the next flip will be a "head?"

Answers

Answer:

50/50 chance

Step-by-step explanation:

Whats the maximum value?

Answers

Answer:

66

Step-by-step explanation:

Step-by-step explanation:

❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️❤️☺️☺️❤️☺️❤️☺️❤️❤️❤️❤️❤️❤️☺️❤️☺️❤️❤️☺️❤️☺️❤️☺️❤️☺️❤️❤️❤️

What is the solution to the inequality? x/2 > 7

Answers

Answer: x > 14

m a th way can help with any similar questions like this !!

Consider the equation of parabola y = 5x - 30x + 45.
Its vertex is located at
( , )

Answers

Answer:

(3, 0 )

Step-by-step explanation:

Given a parabola in standard form

y = ax² + bx + c (a ≠ 0 )

Then the x- coordinate of the vertex is

[tex]x_{vertex}[/tex] = - [tex]\frac{b}{2a}[/tex]

y = 5x² - 30x + 45 ← is in standard form

with a = 5, b = - 30 , then

[tex]x_{vertex}[/tex] = - [tex]\frac{-30}{10}[/tex] = 3

Substitute x = 3 into the function for corresponding value of y

y = 5(3)² - 30(3) + 45 = 45 - 90 + 45 = 0

vertex = (3, 0 )

Answer:

Vertex is (3,0)

Step-by-step explanation:

Given y= 5x^2 - 30x + 45

         y    = 5 ( x^2 - 6x + 9)

               = 5 ( x -3 )^ 2 + 0

Standard formula of parabola is y = a(x - k)^2 + k where vertex is (h,k)

Here, h = 3 and k = 0

So,  Vertex is ( 3, 0)

*EXTRA POINTS* please answer #5 and #6

Answers

Answer:

5, (0, -2)

6, (4, 9)

Step-by-step explanation:

Think About the Process Use the algebra tiles to help you solve the equation 4x - 8 = 20. What is the first step in solving the equation using algebra​ tiles? What is the solution to the​ equation?

Answers

Answer:

The first step would be canceling out the eight getting you 4x = 28 and the solution would be x = 7

Step-by-step explanation:

To simplify you need to add the eight to itself to cancel it out but you have to do it to the 20 too making it 28. Then you have to divide 28 by 4 getting you 7.

The given cylindrical container is used to fill the rectangular prism fish tank with water.

What is the least number of fully cylindrical containers needed to completely fill the fish tank?

Answers

Ok lol can I see some other things that

The number of full cylindrical containers needed to completely fill the fish tank is 30.

What is a cylinder?

In geometry, it is defined as the three-dimensional shape having two circular shapes at a distance called the height of the cylinder.

We know the volume of the cylinder is given by:

[tex]\rm V = \pi r^2 h[/tex]

The volume of a cylinder:

[tex]\rm V = \pi (6/2)^2 (8)[/tex]

V = 72π cubic inches

The volume of cube v = 24×24×12 = 6912 cubic inches

A number of full cylindrical containers are needed to completely fill the fish tank:

= 6912/72π

= 30.55 ≈ 30

Thus, the number of full cylindrical containers needed to completely fill the fish tank is 30.

Learn more about the cylinder here:

brainly.com/question/3216899

#SPJ2

What number makes the equation true? 35 + = 42​

Answers

Answer:

7

Step-by-step explanation:

42 - 35 = 7

The correct answer is 7
35+7=42

Help me pls
put them from least to greatest ​

Answers

Answer: -7/10, -0.35, 1/5, 0.95

Step-by-step explanation:

-7/10 =  -.7

1/5 = 0.2

Answer:

From least to greatest, the correct order is [tex]-\frac{7}{10}[/tex], -0.35, [tex]\frac{1}{5}[/tex], and 0.95.

Step-by-step explanation:

Since all negative numbers are smaller than positive, you immediately know that [tex]-\frac{7}{10}[/tex] and -0.35 are smaller than [tex]\frac{1}{5}[/tex] and 0.95. The greater the absolute value of a negative number is, the smaller that number is. Because [tex]-\frac{7}{10}[/tex] is -0.7, which has a greater absolute value than -0.35, this means [tex]-\frac{7}{10}[/tex] is the smallest number, and -0.35 is the second smallest number. Since [tex]\frac{1}{5}[/tex] is 0.2 which is smaller than 0.95, the correct order from least to greatest would be [tex]-\frac{7}{10}[/tex], -0.35, [tex]\frac{1}{5}[/tex], and 0.95.

The height of a right pyramid with a square base is 4 feet. The length of a side of the
base of the pyramid is 6 feet. What is the slant height, s, of the pyramid?
6 ft

Answers

Answer: I think the answer maybe 12

Step-by-step explanation:

4 x 6  ÷ 2  = 12

There are 14 cans of soup in a pantry, 7 of which contain vegetable beef soup. What is the probability that a randomly selected can will be vegetable beef soup? Write your answer as a fraction or whole number.​

Answers

Answer:

1/2

Step-by-step explanation:

There is a 7 in 14 chance of randomly selecting a can of vegetable beef soup. In fraction form, that would be a 7/14 chance. Simplifying the fraction would bring us to 1/2, our final answer.

Please help.
Is algebra.
PLEASE HELP NO LINKS OR FILES.
I don't want links.

Answers

It would be B! :) have a good day

The time required to drive a fixed distance varies inversely as the speed. It takes 40 hr at a speed of 10 km/h to drive a fixed distance. How long will it take to drive the same distance at a speed of 8 km/h?

Answers

Answer:

50 hours

Step-by-step explanation:

Given data

Time=40hr

Speed=10km/hr

Let us find the fixed distance first

Speed= distance/Time

10= distance/40

distance= 10*40

distance= 400miles

Now our speed= 8km/h

hence the time is

8= 400/time

time= 400/8

time=50 hours

Hence the time is 50 hours

you deposit $1050 into an account that pays 7.25% interest per year. find the amount after six year given the following:
a) compounded semiannually b) compounded monthly

Answers

Uhhh this is ap Reese end die die I don’t yuuuu

What is 1/2 in degrees

Answers

Answer:

180

Step-by-step explanation:

half of 360 is 180

What are the solutions to the equation 3^2 + 6 − 31 = −7? & Explain how you determined your answer

Answers

Answer:

The left side

16

does not equal to the right side

7

, which means that the given statement is false.

False

Step-by-step explanation:

Answer:

false

Step-by-step explanation:

9+6-31=-7 -16=-7

2x+y=7
5x+y=9
solve the system of equations

Answers

Answer:

x=66

y=-57

Step-by-step explanation:


−8

≥ -5 ???????????????????????????

Answers

-8>-5 ? Ok s if that’s the question. The answer it’s false

Answer:

If your asking if it’s true or false then it is false

Step-by-step explanation:

If you want to make it a true statement then it would be -8<-5

Other Questions
Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1 Assume a company is preparing a budget for its first two months of operations. During the first and second months it expects credit sales of $48,000 and $76,000, respectively. The company expects to collect 60% of its credit sales in the month of the sale and the remaining 40% in the following month. What is the expected cash collections from credit sales during the first month You would expect a cell with extensive Golgi apparatus to A hypothetical phylogeny for marsupial relatedness is shown here. Macropodidae is the marsupial family. Which of these statements is supported by the phylogenetic tree shown here? Select ALL that apply.A) M. bicolor and M. parma are in the same subspecies category. Eliminate B) M. agilis and M. eugenii share the most recent common ancestor.C) T. thetis and P. xanthpus share the most characteristics in common. D) T. thetis and P. xanthpus share the greatest number of taxa levels than other species. E) M. agilis and M. eugenii share the greatest number of taxa levels than other species. A die with 8 sides is rolled. What is the probability of rolling a number less than 3