Hardware refers to programs and protocols used on a computer system.

True
False

Answers

Answer 1

Answer:

False

Explanation:

Answer 2

Answer:

false

Explanation:

i JUST took the quiz


Related Questions

You are taking a college class. The textbook costs over $150, but you find a PDF of it online for free. If you download the PDF, you are almost certainly guilty of:

breach of contract.

patent violations.

copyright infringement.

data integrity violations.

Answers

Answer:

Copyright infringement.

Answer:

copyright infringement

Explanation:

PLEASE HELP ME ASAP I HAVE AN EXAM SOON!!!!

My ET-2600 printer isn't working. Black and white pages aren't printing, and if I try to print a BW page, it only print a blank sheet of paper.

How to fix?! I have checked the nozzle thingy on the app.

Answers

Answer:

try seeing if the nozzle of the cartridge is clogged

Explanation:

High-level programming languages are (5 points)
O a
closer to human languages
Ob
less time consuming to run
ос
much more in control over the hardware
Od
similar to native machine code

Answers

The answer is A. Closer to human languages

Two parter:

A.) What is wrong with the program segment below? The program does not contain syntax errors.

B.) Fix the programming error(s)

num = 1;

while (num < 9)
{
cout << num;
num = num - 1;
}

Answers

Answer:

the variable num is not declared so the compiler doesn't define it.

add int before num:

int num = 1;

while (num < 9)

{

cout << num;

num = num - 1;

}

now the code will run but it won't stop as it will never break the condition (num < 9).

To register your content with the US Copyright Office, visit copyright.gov to get started. Online
registration usually costs between _____ and _____, and you'll have to send a copy of your completed
work to the U.S. Copyright Office either through the mail or via its website. Once your work is
registered, it will be added to the Library of Congress.
$35 and $55
O $25 and $65
O $15 and $35
O $85 and $105

Answers

Answer:

$35 and $55

Explanation:

Online registration usually costs between $35 and $55 , and you'll have to send a copy of your completed work to the U.S. Copyright Office either through the mail or via its website. The correct option is 1.

What is Copyright?

Copyright is a legal concept that grants creators of original works, such as literary, artistic, musical, and other types of intellectual works, exclusive rights.

These rights give the creators the ability to control how their works are used, distributed, and reproduced, as well as receive monetary compensation for their use.

Depending on the type of work and the filing option selected, online registration with the United States Copyright Office typically costs between $35 and $55 for a single work.

It should be noted that these fees are subject to change, and that additional fees may apply for specific services such as expedited processing or special handling.

Thus, the correct option is 1.

For more details regarding copyright, visit:

https://brainly.com/question/22399852

#SPJ6

Your question seems incomplete, the probable complete question is:

To register your content with the US Copyright Office, visit copyright.gov to get started. Online

registration usually costs between _____ and _____, and you'll have to send a copy of your completed

work to the U.S. Copyright Office either through the mail or via its website. Once your work is

registered, it will be added to the Library of Congress.

$35 and $55$25 and $65$15 and $35$85 and $105

What is the difference between electrical and electronic devices?

Answers

Answer:

A difference is that the electrical devices makes the electrical energy into the other forms of energies, such as heat, light, sound, gravitational, and nuclear. . . The electronic device controls the flow of electrons for performing the task.

Answer:

the different between electrical and electronics devices is the electricity and the power of inside of some devices which are considered most powerful electronics from, because the difference is the battery.

Explanation:

i hope it helps ;)

Multitasking systems _____.

are easier to develop than single programming systems
execute each job faster
execute more jobs at the same time
are used only in large mainframe computers

Answers

Answer: Multitasking systems are able to execute multiple jobs at the same time, hence the name "multitasking systems".

Harrison works in a manufacturing unit and oversees the logistics, including the daily shipping of a large number of packages. Which information system will he use in the unit to keep track of the deliveries?

Answers

Answer:

E. Transaction processing system

Explanation:

Explanation: He will need a transaction processing system to know the amount of logistics available daily and how many to ship and how many to order. Transaction processing system will make him keep track of what transactions take place during the various days to help him give a good report.

_______________is the career cluster that medical professionals are under.

Answers

I think the answer is Doctor ?

Mecanismo que permite conocer si la persona que esta ingresando a un sistema es realmente quien deba y no un intruso

Answers

Answer:

Sistemas de autenticación y seguridad de la información.

Explicación:

La seguridad de la información es un mecanismo que permite saber si la persona que está ingresando a un sistema es realmente quien debería y no un intruso. La seguridad de la información básicamente ayuda a prevenir el acceso no autorizado y permite que la única persona autorizada ingrese al sistema. Los sistemas de autenticación son el mecanismo de seguridad que se utiliza para proteger los datos y los sistemas. Estos sistemas de autenticación también ayudan a garantizar que los usuarios sean la persona autorizada o no.

You manage Windows desktops for your organization. You recently updated all of your workstations to Windows 10. Your organization relies on a particular application, which worked correctly on Windows 7, but now does not run in Windows 10. You have checked the application vendor's website, but they do not provide a Windows 10 update. What are your options for running the application

Answers

Answer:

The options for running a Windows 7 application on Windows 10 are;

1) Run the compatibility troubleshooter

2) Reinstall the app

Explanation:

The most recent version of Windows 10 supports the majority of applications made for versions of Windows before Windows 10, however, in the event that an application does not run on Windows 10 the options available for running the application are;

1) Run the compatibility troubleshooter as follows;

a) Type the application's name in the tax bar search box

b) In the menu showing the application that comes up, right click on the application's name and select the "Open file location option" from among the options menu

c) In the file location, locate and right click the program file which is the .EXE file and select "Properties" from the options menu. In the Properties dialogue box, select the "Compatibility mode"

d) In the "Compatibility mode" tab, select "Run compatibility troubleshooter"

2) Reinstall the app

a) With the app not yet installed on Windows, in the setup files location of the application, right-click the setup .MSI or .EXE application file

b) In the options menu select "Properties" and then the "Compatibility" tab in the "Properties" dialog box

c) On the Compatibility tab select the "Run this program in compatibility mode for" checkbox and select Windows 7 as your desired Windows

d) Click Ok.

What is an "Expert System"?

If you can’t answer pls leave It

Answers

Answer:

program that use artifical intelligents

Explanation:

Expert system, a computer program that uses artificial-intelligence methods to solve problems within a specialized domain that ordinarily requires human expertise.

Is a dot matrix printer an impact or non-impact printer

Answers

i think a non impact printer

Answer:

Impact

Explanation:

Which of the following is a programming language that translates code one line at a time? (5 points)
a
C:
b
Java
с
Machine
d
Python

Answers

Answer:

Python!

Its the only programming language that is an interpreted language

Hope it helped <3

You read an article about someone who leaves USB sticks in college libraries so that people will pick them up, insert them into their laptops, and download malware. This is an example of:

phishing.

eavesdropping.

wiretapping.

social engineering.

Answers

Answer:

social engineering

Explanation:

 

The above scenario of USB use is an example of social engineering.

What is Social Engineering?

This is known to be when a person gets phishing email via any method known as social engineering.

Conclusively, Social Engineering is a term that connote non-technical intrusion that depends on human linkage and it I one where a person is been tricked into breaking normal security means. It often makes use of USB drive for its purpose.

Learn more about social engineering from

https://brainly.com/question/26072214

How might you develop a game where players need strong twitch skills in a way that still makes the game fun for players of all skill levels and abilities?

Answers

Answer:

here ya go

Explanation:

I would suggest either having a default difficult being easy, and if people want to be challenged they can increase it, or try to balance how much of the game requires strong twitch skills.

What is Polymorphism in programming? Explain in your own words with examples.

Answers

Answer:

A computer program which can change on it's own, such as a polymorphic virus that is harder to detect. It can change it's own code to achieve the same goal but have a different structure.

Explanation:

Answer:

Polymorphism is a feature of object-oriented

programming languages that allows a specific routine to use variables of different types at different times. Polymorphism is the ability of a programming language to present the same interface for several different underlying data types.

Explanation:

hope it helps

PLEASE HELP WILL GIVE BRAINLIEST

Answers

Answer:

Explanation: answer is b) the row comes first  in the  element of an index

In python please!! Write the definition of a function named countPos that needs integer values from standard input until there are none left and returns the number that are positive. The function must not use a loop of any kind.

Answers

Answer:

Explanation:

The following code is written in Python it doesn't use any loops, instead it uses a recursive function in order to continue asking the user for the inputs and count the number of positive values. If anything other than a number is passed it automatically ends the program.

def countPos(number=input("Enter number: "), counter=0):

   try:

       number = int(number)

       if number > 0:

           counter += 1

           newNumber = input("Enter number: ")

           return countPos(newNumber, counter)

       else:

           newNumber = input("Enter number: ")

           return countPos(newNumber, counter)

   except:

       print(counter)

       print("Program Finished")

countPos()

Use the drop-down menus to match each description with the part of a report where it is located.

named moons in the solar system:
page number printed at the bottom of page 1:

page number printed at the bottom of page 20:

group of data titled “Hawks” in a report on species of migrating birds:

report titled “Technology in the Workplace”:

calculation printed beneath a group of data:

date of a report printed at the top of pages 2–100:

Answers

Answer:

1) Detail

2) Report footer

3) Page footer

4) Group Header

5) Report header

6) Group footer

7) Page header

Explanation:

I just did the assignment

put true or false..

1. Static web pages cannot be edited or visitor makes any handle with them. ( )

2. Name attribute used for display a text on the button. ( )

3.submit button used to clear input fields from any previous data ( )

4.HTML language isn't enough to make a confirmation to the data entry ( )​

Answers

1.) False

2.) False

3.) False

4.) False

Software is:

A. storage-related information technology.

B. programs that help hardware accomplish tasks.

C. the opposite of firmware.

D. all of the above.

Answers

I think the answer is A

Briefly explain the main difference between how to connect a new office computer in the SHSS office to the internet and how to connect a standalone computer in your house to the internet

Answers

Answer:

Once you've set up your computer, you may want to purchase home Internet access, up a home wireless network, commonly known as Wi-Fi, so you can connect multiple. Now that you know about the different types of Internet service, you can do. The primary piece of hardware you need is a modem.

20 POINTS-
can someone help with this?

Answers

Answer:

large storage= data warehouse

data from daily= world wide

data storaage= transactional

online data= relational

I rlly don't know I'm kinda guessing here for don't take my word to heart it's been a bit since I've learned this

In which phase of website design does the designer create a mock-up aimed at the target user? A. learning B. planning C. design D. development E. testing and delivering

Answers

Answer:

C. design

Explanation:

HTML is an acronym for hypertext markup language and it is a standard programming language which is used for designing, developing and creating web pages.

Generally, all HTML documents are divided into two (2) main parts; body and head. The head contains information such as version of HTML, title of a page, metadata, link to custom favicons and CSS etc. The body of the HTML document contains the contents or informations that a web page displays.

In the design phase of a website design, the website designer create a mock-up aimed at the target user. A mock-up is a graphical representation or illustration of a graphic design and as such isn't responsive.

This ultimately implies that, a mock-up or model can be used by a website designer to illustrate or show the target user the look and feel of a website, so as to help these users have a better understanding of the specific elements and structure associated with it.

When comparison shopping, all of these hint at a good deal EXCEPT_____________________.

Answers

Answer:

lower-priced models offer more features

Explanation:

Hardware failure, power outages, and DOS attacks will affect:

data confidentiality.

data integrity.

data verification.

data availability.

Answers

Answer:

The answer should be data availability

Examine the weather map.

A weather map of the United notes. The following are shown on the map: major cities with high and low temperatures; high and low pressure systems; types of precipitation, fronts.

Which weather forecast would be accurate based on this weather map?

Rain is expected in Billings.
It will be cold in Atlanta.
Miami will have sunny weather.
Minneapolis will be stormy.

Answers

Answer:

A. Rain is expected in Billings.

Explanation:

Rain is expected in Billings would be accurate based on this weather map.

What is Weather map?

A weather map is a map of the world or a portion of it that uses symbols to depict the weather conditions at a given time, including temperature, pressure, wind speed and direction, humidity, clouds, visibility, and type and amount of precipitation.

The trained observers record the temperature, pressure, wind speed and direction, cloud cover, and precipitation amounts in observatories and meteorological stations. Using symbols, these observations are entered on a weather map. '

'

As a result, a weather map shows the weather factors for a region at a specific time that are denoted with recorded symbols. It makes the current weather conditions clear.

Therefore, Rain is expected in Billings would be accurate based on this weather map.

To learn more about weather map, refer to the link:

https://brainly.com/question/1674348

#SPJ3

ANSWER ALL QUESTIONS CORRECTLY PLEASE AND YOU WILL GET A BRAINLIEST AND 10+ POINTS!!!! I WOULD REALLY APPRECIATE IT

Through the use of ICT and emerging technology in todays world, a number of sectors have been affected (whether in a positive or negative way). Three sectors in which ICT has had an impact are the health care, education, and banking sector.
Define the term ICT?

List three ICT tools that are commonly used in the education system?


Identify two ways in which ICT has impacted the education sector?

Answers

Answer: uhm can u explain what ICT is so i can understand the questions pls when i whould gladly help :)

Explanation:

Games for which of these devices have the lowest graphical quality and computing requirements? ASAPP!!!!!
A. PDAs
B.handheld consoles
C. tablets
D.smartphones
E. feature phones

Answers

Answer: A. PDAs

Explanation:

Personal Digital Assistants (PDAs) allowed for a user to carry out computational tasks such as calendars and planning in the time before smartphones. They were extremely useful to business people.

They did not however, have the best graphics for running games. This meant that any games on a PDS would be of pretty low graphic quality and require low computing requirements as well.

Answer:

A - PDA

Explanation:

PLATO

Other Questions
Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Determine if the data is biased or not biased: A shirt manufacturer wants to check quality control of their products. The plant manager decides to check every 5th shirt inspected by Inspector D. There are 15 inspectors in the plant. BiasedNot Biased