Given: f(x) = xand g(x) = x +1, find g[f(-2)].
1
5
-3

Answers

Answer 1

Answer:

-1

Step-by-step explanation:

f(x) = x

g(x) = x +1,

g[f(-2)].

First find f(-2) = -2

Then substitute into g(x)

g(-2) = -2+1

        =-1

Answer 2
After all the breaking down I would say it’s negative one (-1)

Related Questions

Algebra 1 help please
Solve 19a + 11b = 12a + 15 for a.
Select one:
a. 77 – 11b)
b. (15 + 11b 1/7
c. 7 ( 15 – 11b )
d. (15 – 11b)

Answers

Answer:

a = (15-11b)/7

Step-by-step explanation:

19a + 11b = 12a + 15

Subtract 12a from each side

19a-12a + 11b = 12a-12a + 15

7a +11b = 15

Subtract 11b from each side

7a+11b-11b = 15 -11b

7a = 15-11b

Divide by 7

7a/7 = (15-11b)/7

a = (15-11b)/7

Answer:

A = (15-11b)/7

Step-by-step explanation:

To most closely estimate the difference below, would you round the numbers to the nearest ten thousand, the nearest thousand, or the nearest hundred? Explain. 62,980 - 49,625 =?

Answers

Answer:

To most closely estimate the difference, I would round 62,980 to the nearest thousand, so it will be 63,000. That is because when rounding, 63,000 is large enough so that adding will be easy, and 62,980 is relatively close to 63,000.

I would round 49,625 to the nearest thousand, since it would make the subtraction easier and 49,625 is only 375 units away from 50,000.

63,000 - 50,000 = about 13,000.

Hope this helps!

63,000-50,0000=13,0000 you need to round i hope it helps

If a = 4 and b = 7, what is the value of the following expression? 20 ÷ a + 7 • b A. 28 B. 84 C. 54 D. 33

Answers

Answer:

54

Step-by-step explanation:

20 ÷ a + 7 • b

Let a = 4 and b = 7

20 ÷ 4 + 7 • 7

Multiply and divide first

5 + 49

Then add

54

Answer:

54

Step-by-step explanation:

a=4    b=7

20/4=5

7✖️7=49

5+49=54

Hope this helps you!

If sin ZA = { and cos ZA = }, what is tan ZA?

Answers

Answer:

A: 3/4

Step-by-step explanation:

sine is the length of the opposite side / length the hypotenuse side

cosine is the length of the adjacent side / length the hypotenuse side

using what's given:

the opposite side has a length of 3the adjacent side has a length of 4the hypotenuse side has a length of 5

Tangent is the ratio between the opposite side length and the adjacent side length (opp/adj). With our givens, this means tan(A) = 3/4. See image for more.

Answer:

A

Step-by-step explanation:

Please help!!! Question is below

Answers

Answer:

A. Obtuse

Step-by-step explanation:

Well we can cross out C and D just by looking at the triangle because the triangle is not equal and there is no right angle.

Also it is not B an acute because not all the angles are acute.

Hence, the answer is A. Obtuse

Answer:

[tex]\boxed{\mathrm{A}}[/tex]

Step-by-step explanation:

An obtuse triangle is a triangle with one obtuse angle and two acute angles.

An obtuse angle is an angle greater than 90 degrees.

An acute angle is an angle less than 90 degrees.

Angle C is an obtuse angle, it is greater than a right angle or 90 degrees.

Angles B and A are acute angles, they are less than a right angle or 90 degrees.

HELP NOW A dartboard has 20 equally divided wedges, and you are awarded the number of points in the section your dart lands in. If you are equally likely to land in any wedge, what is the probability you will score more than 10 points?

Answers

Answer:

1/2 (or) 0.50 (or) 50%

Step-by-step explanation:

10 out of 20 wedges are worth more than 10.

10/20 = 1/2 (or) 0.50 (or) 50%

Answer:

0.75

Step-by-step explanation:

David is making rice for his guests based on a recipe that requires rice, water, and a special blend of spice, where the rice-to-spice ratio is 15:115:115, colon, 1. He currently has 404040 grams of the spice blend, and he can go buy more if necessary. He wants to make 101010 servings, where each serving has 757575 grams of rice. Overall, David spends 4.504.504, point, 50 dollars on rice. How many servings can David make with the current amount of spice he has

Answers

Answer:

  8 servings

Step-by-step explanation:

At the ratio of 15:1, the 75 grams of rice in one serving will require 75/15 = 5 g of spice. David's inventory of 40 g of spice is enough for ...

  40 g/(5 g/serving) = 8 servings

Only 8 servings can be made with the available spice.

Rice to spice ratio = 15 : 1

Number of grams per serving = 75 grams

Grams of spice available = 40 grams

Grams of rice, r required for available spice :

15 grams of rice = 1 gram of spice

r grams of rice = 40 grams of spice

Cross multiply :

r = (40 × 15)

r = 600 grams

The grams of rice which can go with the available spice :

Number of servings = grams of rice / grams per serving

Number of serving = 600 grams / 75 grams

Number of grams per serving = 8

Hence, The number of servings which can be made with the available spice is 8 servings

Learn more : https://brainly.com/question/18796573

23 points! Paige has 3 coats: a pink one, a red one, and a white one. She has a black scarf, a gray scarf and 1 set of white gloves. Determine the different combinations Paige has for staying warm if she always wears a coat, a scarf, and gloves. For your answer, list the total number of possibilities and all possible combinations she has.

Answers

Answer:

6 combinations

Step-by-step explanation:

3 coats => Pink, Red, White

2 Scarves => Black, Grey

Gloves => Only 1

So the combination are drawn in the tree diagram below.

Hi there! Hopefully this helps!

---------------------------------------------------------------------------------------------------------

Since she has 3 coats, 2 scarfs, and 1 glove:

She has 6 ways to choose a coat, a scarf, and a glove(s).

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

My 6 combinations:

1.) Red coat, black scarf, white glove(s).

2.) White coat, grey scarf, white glove(s).

3.) Pink coat, black scarf, white glove(s).

4.) Red coat, grey scarf, white glove(s).

5.) White coat, black scarf, white glove(s).

6.) Pink coat, grey scarf, white glove(s).

The height of the trunk is 26 inches the length of the trunk is 50 inches. The tv is 54 inches wide. And 96 inches in height Use the Pythagorean theorem to calculate the length of the diagonal of the trunk.

Answers

Answer:

The length of the diagonal of the trunk is 56.356011 inches

Step-by-step explanation:

According to the given data we have the following:

height of the trunk= 26 inches

length of the trunk= 50 inches

According to the Pythagorean theorem, to calculate the length of the diagonal of the trunk we would have to calculate the following formula:

length of the diagonal of the trunk=√(height of the trunk∧2+length of the trunk∧2)

Therefore, length of the diagonal of the trunk=√(26∧2+50∧2)

length of the diagonal of the trunk=√3176

length of the diagonal of the trunk=56.356011

The length of the diagonal of the trunk is 56.356011 inches

The pair of points is on the graph of an inverse variation. Find the missing value.
(5, 4) and (x, 7)

Answers

Answer:

20/7 or 2 and 6/7

Step-by-step explanation:

convert it into the equation 5=k/4

so 5x4 is 20

k=20

then x=20/y

and y is 7

so the answer is 20/7

find the value of a in this picture below

Answers

Answer:

[tex]\boxed{a=40}[/tex]

Step-by-step explanation:

Angles on a straight line add up to 180 degrees.

[tex]a[/tex] is equivalent to all the other [tex]a[/tex].

Put up an equation and solve for [tex]a[/tex].

[tex]60+a+a+a=180[/tex]

[tex]3a+60=180[/tex]

[tex]3a=120[/tex]

[tex]a=40[/tex]

Answer:

Step-by-step explanation:

in the given figure;

a+60deg.+a+a=180 deg.

=> 3a+60=180

=> 3a=180-60

=> 3a=120

=> a=120/3

   =40 deg.

A manufacturing machine has two processes. One of them is repeated 4 times and the second only once. The entire cycle can take no longer than 3 minutes. Which graph represents the overall equation represented by this scenario (all points may not apply to the scenario)? On a coordinate plane, a dashed straight line has a negative slope and goes through (0, 3) and (1, negative 1). Everything to the right of the line is shaded. On a coordinate plane, a dashed straight line has a negative slope and goes through (0, 3) and (1, negative 1). Everything to the left of the line is shaded. On a coordinate plane, a solid straight line has a negative slope and goes through (0, 3) and (1, negative 1). Everything to the right of the line is shaded. On a coordinate plane, a solid straight line has a negative slope and goes through (0, 3) and (1, negative 1). Everything to the left of the line is shaded.

Answers

Answer:

The graph in the attached figure

Step-by-step explanation:

Let

x -----> time of the first process in minutes

y -----> time of the second process in minutes

we know that

The time of the first process multiplied by 4 (because is repeated 4 times) plus the time of the second process multiplied by 1 (because is repeated only once) must be less than or equal to 3 minutes

so

The inequality that represent this situation is

The solution of the inequality is the shaded area below the solid line

The equation of the solid line is

The y-intercept of the solid line is the point (0,3)

The x-intercept of the solid line is the point (0.75,0)

The slope of the solid line is negative m=-4

using a graphing tool

The solution is the shaded area

The graph in the attached figure

Remember that the time cannot be a negative number

Answer: The answer is the last graph so D

Step-by-step explanation: Pogchamp

Complete this item. Identify angle1 and angle2. Select all that apply off the following terms: acute, right, obtuse, adjacent, vertical, complementary, supplementary.

Answers

Answer:

Angles 1 and 2 are both obtuse and adjacent.

Step-by-step explanation:

We can go about this systematically.

Acute: They are not acute. Looking at the angles, we can assume that they are greater than 90°.

Right: Greater than 90°, not equal, so not right.

Obtuse: Greater than 90°, so it's obtuse.

Adjacent: The angles are next to each other, so they are adjacent.

Vertical: They share a vertex, but they are not opposite to each other.

Complementary: They do not form a right angle together.

Supplementary: They do not form a straight angle together.

---

I hope this helps, let me know if you have any questions.

Correct Answers:

right

vertical

supplementary

I finished the quiz, it's correct. They're both 90 degree [right] angles, they're across from each other and therefore they're vertical, and they both add up to 180 degrees total, which means that they're supplementary.

Does anyone know this need help!

Answers

Answer:

Lead

Step-by-step explanation:

According to the chart, we can see that lead has the highest number here, so lead has the highest freezing / melting point in this chart.

If we were looking for the element with the lowest freezing / melting point, then we would look for the lowest number, which would belong to Helium, at -272.

pre-algebra !!!. A class contains 3 female and 9 male students. Find the probability that a student chosen at random is a male, and then a second student chosen at random from the remaining students is also male. 9/16 3/4 1/2 6/11 None of the above

Answers

Answer:

D

Step-by-step explanation:

The first student is from a class of 12.

The first student = 9/12 for the fist male.

The second male is 8 out of 11.

The probability of both being males is

9/12 * 8/11 = 3/4 * 8/11 = 6/11

The answer is 6/11 aka D

One day the temperature was 72°F. That night, the temperature was 44°F. What number represents the change in temperature?

Answers

Answer:

28°F

Step-by-step explanation:

We can find the change in temperature by subtracting 44 from 72:

72 - 44 = 28

So, the change in temperature was 28°F

The answer would be 28° Fahrenheit

Reason being is when you would like to find the difference between 2 numbers, you take the larger one and subtract it by the smaller, thus giving you how far apart they are

In this case 72°-44°=28°

can you draw a quadrilateral with no parallel lines and at least one right angle?​

Answers

Answer:

Yes

Step-by-step explanation:

We can draw a quadrilateral with no parallel lines and at least one right angle

Answer:

Yes

Step-by-step explanation:

It's possible to draw a quadrilateral with no parallel lines and with 1 right angle        

I really hope this helps I know how you feel (:-D)

Graph the linear function whose equation is
y - 2 = - * (x + 1) by following these steps:

Answers

Answer:

The slope is -2/3

Step-by-step explanation:

With this its easier to get all of the x's on one side.

distribute the -2/3 to the x and 1. Also add a 2 on each side.

Thats leaves you with y=-2/3x+4/3

You than want to make a chart of x's and y's so you know what this graph looks like

x|y

-3|(10/3)

-2|(8/3)

-1|2

0|(4/3)

1|(2/3)

2|0

3|(-2/3)

To find the slope, it's (y2-y1)/(x2-x1)

So in this case, (0-2)/(2+1)

The slope is (-2/3)

Answer:

Slope = -2/3

Point = (-1,2)

Plot the given point = (-1,2)

Use the slope to plot one more point = (2,0)

Step-by-step explanation:

Mandana is ordering new tile for her kitchen floor. The area of the floor is 111.8 square feet, and she wants to order between 15% and 20% extra of the materials. Which of the following is a reasonable amount of tile for Mandana to order?

Answers

Answer:

132 tiles

Step-by-step explanation:

We would just take the average of 15% and 20% which would be 17.5% and we could round up to 18% so 18% of 111.8 is 20.124 and if you add them together you would get 131.9 and that rounds up to 132 tiles.

solve x^2+5x-2=0 Enter your answers,as exact values, in the boxes.

Answers

Answer:

                 √33

x = -5/2 ± ---------

                     2

Step-by-step explanation:

Through completing the square, we get:

x^2 + 5x + (5/2)^2 - (5/2)^2 - 2 = 0, or

(x + 5/2)^2 - 25/4 - 2 = 0.

This simplifies to

(x + 5/2)^2 = 33/4

Taking the square root of both sides yields:

x + 5/2 = ±√(33/4), which can be solved explicityl for x:

                 √33

x = -5/2 ± ---------

                     2

2 3 4 5 6 7 8 9 10 TIME REMAINING 58:34 The graph for the equation y = x minus 4 is shown below. On a coordinate plane, a line goes through (0, negative 4) and (4, 0). Which equation, when graphed with the given equation, will form a system that has an infinite number of solutions? y minus x = negative 4 y minus x = negative 2 y minus 4 = x y + 4 x = 1 Mark this and return Save and Exit

Answers

Answer:

The answer is y minus x = negative 4

or c for short

Step-by-step explanation:

Answer:

a

Step-by-step explanation:

i got it right on the test

Write an equation of the line passing through the given point and satisfying the given condition. Give the equation (a) in slope-intercept form and (b) in standard form.
(6, 2); parallel to 8x - y = 4
(a) Write the equation of the line in slope-intercept form.
(Simplify your answer. Use integers or fractions for any numbers in the equation.)

Answers

Answer:

(a) y=8x-46

(b) 8x-y=46

Step-by-step explanation:

-y=-8x+4

y=8x+4

We know that 8 is the slope, and if we need a equation parallel to this line, then it will have the same slope.

Substitute (6,2)

2=8(6)+b

2=48+b

b=-46

The final answer is y=8x-46

?help..........thanks you for helping me

Answers

Answer:

Step-by-step explanation:

cost of one box = RS20

IT IS 20 TIMES MORE THAN COST OF ONE BOX

Answer:

The cost of 1 small box of mixed organic vegetables is $20. The cost of 20 small boxes of vegetables is $380 more than the cost of 1 small box.

Step-by-step explanation:

Since the cost of 9 small boxes is $180, we can divide both by 9 to get the price of one small box. 180/9=20. The cost of 20 small boxes is 20 boxes multiplied by 20 dollars, which is 400 dollars. $400-$20=$380.

Write a linear equation in point-slope form for the line that goes through
(-1,1) and (1,-5).
A. y+1 = -3(x+1)
B. y-1 = 3(x+1)
C. y+ 1 = 2(x - 1)
D. y-1=-3(x + 1)

Answers

Answer:

y -1 = -3(x+1)

Step-by-step explanation:

First find the slope

(-1,1) and (1,-5)

m = (y2-y1)/(x2-x1)

   = (-5-1)/(1--1)

   =-6/ (1+1)

   = -6/2

   = -3

We are using point slope form

y-y1 = m(x-x1)  where m is the slope

y - 1 = -3( x - -1)

y -1 = -3(x+1)

Answer:

The answer is option D.

Step-by-step explanation:

Equation of a line is y= mx + c

where m is the slope

Slope of the line using points

(-1,1) and (1,-5) is

[tex] \frac{ - 5 - 1}{ 1 + 1} = \frac{ - 6}{2} = - 3[/tex]

Therefore the equation of the line using point (-1,1) is

y - 1 = - 3( x + 1)

Hope this helps you

The function ƒ(x) = 6x is vertically shrunk by a factor of ½ and translated 9 units in the negative y- direction. Select the correct graph of the resulting function.

Answers

Step-by-step explanation:

The graph on the left is f(x). The roots -- the x-intercepts -- are −3, −1, 2. The middle graph is f(−x), which is its reflection about the y-axis. The graph on the right is −f(x), which is its reflection about the x-axis.

Answer:

The graph on the left is f(x). The roots -- the x-intercepts -- are −3, −1, 2. The middle graph is f(−x), which is its reflection about the y-axis. The graph on the right is −f(x), which is its reflection about the x-axis.

Step-by-step explanation:

this was correct

Write each of the following expressions without using absolute value: PLEASE HELP I WILL MAKE BRAINLIEST TO WHOEVER GETS BOTH OF THEM RIGHT

Answers

Answer:

7

Step-by-step explanation:

the answer is 7 hope this helped

The monthly salary of a salesman of a departmental store is Rs 12,500 and an additional payment of 0.5 % on the total monthly sale is provided as commission.

i) Calculate his total income in a month if he makes a total sale of Rs 7,20,000 in that month.

ii) What should be his total sale in the next month so that he can receive a total income of Rs 20,000 in the month?​

Answers

Answer:

i. [tex]Total\ Income = Rs\ 16,100[/tex]

ii. [tex]Monthly\ Sales = Rs\ 1,500,000[/tex]

Step-by-step explanation:

Given

[tex]Salary = Rs\ 12,500[/tex]

Commission = 0.5% of Monthly Sales

Calculating his total income is total sales is  Rs 720,000

[tex]Total\ Income = Salary + Commission[/tex]

Substitute (0.5% of Monthly Sales) for Commission

[tex]Total\ Income = Salary + (0.5\%\ of\ Monthly\ Sales)[/tex]

Substitute Rs 720,000 for Monthly Sales and Rs 12,500 for Salary

[tex]Total\ Income = Rs\ 12,500 + 0.5\%\ of\ Rs\ 720,000[/tex]

[tex]Total\ Income = Rs\ 12,500 + 0.5\%\ * Rs\ 720,000[/tex]

Convert % to decimal

[tex]Total\ Income = Rs\ 12,500 + 0.005\ * Rs\ 720,000[/tex]

[tex]Total\ Income = Rs\ 12,500 + Rs\ 3,600[/tex]

[tex]Total\ Income = Rs\ 16,100[/tex]

Calculating his total sales if total income = Rs 20,000

Recall that;

[tex]Total\ Income = Salary + Commission[/tex]

Substitute Rs 20,000 for Total Income; Rs 12,500 for Salary and (0.5% of Monthly Sales) for Commission

[tex]Rs\ 20,000 = Rs\ 12,500 + 0.5\%\ of\ Monthly\ Sales[/tex]

Subtract Rs 12,500 from both sides

[tex]Rs\ 20,000 - Rs\ 12,500 = Rs\ 12,500 - Rs\ 12,500 + 0.5\%\ of\ Monthly\ Sales[/tex]

[tex]Rs\ 7,500 = 0.5\%\ of\ Monthly\ Sales[/tex]

[tex]Rs\ 7,500 = 0.5\%\ *\ Monthly\ Sales[/tex]

Divide both sides by 0.5%

[tex]\frac{Rs\ 7,500}{0.5\%} = \frac{0.5\%\ *\ Monthly\ Sales}{0.5\%}[/tex]

[tex]\frac{Rs\ 7,500}{0.5\%} = Monthly\ Sales[/tex]

Convert % to decimal

[tex]\frac{Rs\ 7,500}{0.5\%} = Monthly\ Sales[/tex]

[tex]\frac{Rs\ 7,500}{0.005} = Monthly\ Sales[/tex]

[tex]Rs\ 1,500,000 = Monthly\ Sales[/tex]

[tex]Monthly\ Sales = Rs\ 1,500,000[/tex]

Explain how to create a Stem-and-Leaf plot using the 6 rules. And write down what the 6 rules are.

Answers

Answer:

The 6 rules/steps are below

Step-by-step explanation:

1. determine the smallest and largest number

2. Using the largest and smallest number, make sure that your graph can fit both of those numbers

3. identify the stems/tens place

4. fill in the leaves/ones place

5. Sort them from lowest to highest

6. Check

pls help !
simplify

Answers

Answer:

B

Step-by-step explanation:

Sqaure roots can be rewritten as fractions.

The numerator will be rewritten as 6^(1/4)

The denominator will he written as 6^(1/5)

Now u can subtract the power, but u have to find a common denominator so it is now (5/20)-(4/20)

The denominator stays the same so you are left with 1/20 which is still the power over 6

6^1/20

Answer:

[tex]6^{\frac{1}{20} }[/tex]

Step-by-step explanation:

[tex]6^{\frac{1}{4} } /6^{\frac{1}{5} }[/tex]

1/4 - 1/5 = 1/20

Plz help me 3y+x=7 4x-2y=0

Answers

Answer: 3

Step-by-step explanation:

Other Questions
John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False