Felix can grow 6 plants with every seed packet. Write an equation that shows the relationship between the number of seed packets x and the total number of plants y. Write your answer as an equation with y first, followed by an equals sign.

Answers

Answer 1

Answer:

I believe it’s:

Y= 6x

Step-by-step explanation:


Related Questions

Brendon sells tires at the local auto parts store. He told a customer that the tire width for a new tire was 21.5 centimeters. Which of the following describes the tire width for the new tire? Help please thank you!!!

Answers

Answer:

215 mm

Step-by-step explanation:

1 cm = 10 mm

21.5 cm * (10 mm)/(1 cm) = 215 mm

Answer: 215 mm

4.5/w = 3

what is the W?​

Answers

Answer:

w=1.5 or w=13.5

Step-by-step explanation:

this is one answer:

multiply w on both sides to leave u with

4.5=3w

divide both sides by 3

[tex]\frac{4.5}{3}=\frac{3w}{3}[/tex]

1.5=w

_____________________

this is the second one if the first one is wrong:

multiply 4.5 on both sides so that the 4.5/w would leave u with just only w alone.

then 3*4.5=13.5

w=13.5

hope dis helps if not then im not dat smart enough ;?

Help rn please!! Urgent

Answers

Answer:

x² + 2x - 15 = 0

Step-by-step explanation:

- 5 and 3 are zeros of quadratic function.

(x + 5)(x - 3) = 0

x² + 2x - 15 = 0

If using the method of completing the square to solve the quadratic equation x^2-19x+9=0 which number would have to be added to "complete the square"?

Answers

Answer:

90.25

Step-by-step explanation:

Given the quadratic equation x^2-19x+9=0 re arranging we have;

x^2-19x+9 - 9=0 -9

x^2-19x = - 9

In order to complete the square we would add  a number to both sides and the number will be the square of the half of coefficient of x in the expression as shown.

Coefficient of x = -19

half of coefficient of x = -19/2

square of the half of coefficient of x = (-19/2)²

square of the half of coefficient of x = 361/4

square of the half of coefficient of x = 90.25

Hence the number that would have to be added to "complete the square" is 90.25


Is 4 to 7 the same as 7 to 4? Explain why or
why not?

Answers

Step-by-step explanation:

4 times of 7 (7 + 7 + 7 + 7 = 28) is the same as 7 times of 4 (4 + 4 + 4 + 4 + 4 + 4 + 4 = 28)

4^7 (4 x 4 x 4 x 4 x 4 x 4 x 4 = 16384) is not the same as 7^4 (7 x 7 x 7 x 7 = 2401)

Answer:

Yes.  The difference between them are the same.  Both have the same number of units between them,

Step-by-step explanation:

Find the slope and the y-intercept of the line.
y = 8x-1

Answers

Answer:

Slope: 8 Y-intercept: -1

Step-by-step explanation:

This equation follows the format of y = mx + b. M would be the slope, b would be the y-intercept.

Michelle drew a purple line that was 1/2 of an inch long then she drew a green line that was 1/6 of an inch long how much longer what is the purple line than the green line

Answers

Answer:

[tex]\dfrac{1}{3}[/tex]

Step-by-step explanation:

Given length of purple line = [tex]\frac{1}{2}\ inch[/tex]

Given length of green line = [tex]\frac{1}{6}\ inch[/tex]

To find:

How much longer is the purple line than the green line ?

Solution:

To find the required length, we have to subtract the length of green line from the length of purple line.

i.e.

The required answer =

[tex]\frac{1}{2}-\frac{1}{6}\\\text{Taking LCM of 2 and 6, we get 6}\\\Rightarrow \dfrac{3-1}{6}\\\Rightarrow \dfrac{2}{6}\\\Rightarrow \bold{\dfrac{1}{3}}[/tex]

Therefore, the answer is:

Purple line is [tex]\frac{1}{3}[/tex] of an inch longer than the green line.

Help me<3. Its maph ugggggg brain hurt......*dieing noises*

Answers

Step-by-step explanation:

There are several ways to solve this, but the only one I remember how to do is with the pythagorean theorem. The distance between A and B is the same as a hypotenuse of a triangle with a height the absolute value of y1-y2 and a base of the absolute value of x1-x2.

For example, in the first question, the coordinates are (1,2) and (9,8), so we have a triangle with base 8(9 - 1) and 6(8 - 2). Now we just need to plug that into the pythagorean theorem like so:

[tex] {a}^{2} + {b}^{2} = {c }^{2} [/tex]

or plugging our numbers in,

[tex]8^{2} + {6}^{2} = 100[/tex]

The answer is the radical of the answer, in this case 10.

So if this makes sense, go ahead and try to work the next three out on your own, and if you still need help let me know <:

Hope this helps Bucke!

Simplify the expression.
Can someone explain to me how to get the answer? Thanks!

Answers

Answer:

11x^2+2x+9

Step-by-step explanation:

2+(2+6)⋅x^2+2x+3x^2+7

2+(8)⋅x^2+2x+3x^2+7

2+8x^2+2x+3x^2+7

9+8x^2+2x+3x^2

9+8x^2+2x+3x^2

11x^2+2x+9

Write 321.35 in scientific form.​

Answers

Answer:

3.2135 x 10^2 if you're looking for scientific notation

Step-by-step explanation:

Cardi B is buying a condo built within
a skyscraper. She learned that each floor is 13 feet tall.

Write an expression to represent the height of the skyscraper if it has f
floors, where f is the number of floors.

How tall, in feet, would her condo be in the skyscraper if she was on the 26th floor?
PLEASE HELP... 25 points

Answers

Answer:

13f is equation

which is floors times height

Step-by-step explanation:

26*13=338

338 feet tall

Brainliest appreciated!

Answer:

(H)=13f and  the height is 338ft

Step-by-step explanation:

height of skyscraper=h

f=floors

height per floor is 13ft...

(H)=13f

(H)=13*f, if f is 26, then to find height multiply 13 by 26

doing this you get 13*26=338ft

4. If you are given that plq and p || r,
what can you conclude about lines q and r?
State the theorem that justifies that conclusion.

Answers

What I don’t get that

The price of a remote control car was reduced from $200 to $120. By what percentage was the
price of the remote control car reduced?

Answers

Answer:

%40

Step-by-step explanation:

Ramon earns $1,665 each month and pays $53.20 on electricity. To the nearest tenth of a percent, what
percent of Ramon's earnings are spent on electricity each month?

Answers

You need to add
Tell me what you think it is and I will help you

The number of tons of wheat the government can afford to buy if it spends total of $100 million, wheat costs $300 per ton, and it must buy 5 fighter planes at $15 million each.

Answers

Total amount, T = $100 million.

Cost of wheat per ton, C = $300 .

Price per fighter plane, c = $15 million.

Now,

Price of 5 fighter planes, P = $( 15 × 5 ) = $75 million.

Amount left = $( 100 - 75 ) = $25 million.

So,

Number of tons of wheat government can buy is :

[tex]n=\dfrac{25\times 1000000}{300}\\\\n = 83333.33\ tons[/tex]

Therefore, number of tons of wheat the government can afford is 83333.33 tons.

Hence, this is the required solution.

How many solutions does r > 5 have?

Answers

Answer: It can have infinite

Step-by-step explanation:

because numbers never finish

Sumiko and Jandella ran the bleachers together today at Poly High School. Sumiko runs these same bleachers every 6 days and Jandella runs them every 16 days. The soonest they will see each other again is in days.

Answers

Answer:

48 days

Step-by-step explanation:

Given that :

Sumiko runs bleachers every 6 days

Jandella runs bleachera every 16 days

The soonest they will see each other again is in days can be obtained by getting the lowest common multiple of 6 and 16

Multiples of

6 : 6, 12, 18, 24, 30, 36, 42, 48, 54,...

16 : 16, 32, 48, 64,...

Lowest common multiple of 6 and 16 = 48

Hence, the soonest they'll see each other again is in 48 days

2. How many solutions does the system have?
y - 4x = -3
2y - 8x = 10
a. one solution
b. two solutions
c. infinitely many solutions
d. no solution

Answers

Answer:

no solution both

Step-by-step explanation:

Infinite solutions because any number can substitute x

Question 1
Which of the following statements is NOT true?

Answers

Answer:

the bottom one

Step-by-step explanation:

They are both the same ab and bc but im not entirely  sure

Because AB, AC, and BC describe the same line, we conclude that the last option is the false one.

Which of the statements is not true?

On the graph, we can see a line that contains points A, B, and C.

Now we want to see which statement is false.

Now, because A, B, and C are on the same line, is trivial that:

AB, AC, and BC (these 3 lines) have the same slope, because these are 3 different names for the exact same line.

Then we can conclude that the incorrect statement is the last one.

If you want to learn more about lines:

https://brainly.com/question/14323743

#SPJ2

Give the formula for finding the 'nth term' for this specific arithmetic sequence: 5, 8, 11, 14... (Be sure to fill in numbers for A(1) and d)

Answers

9514 1404 393

Answer:

  A(n) = 5 +3(n -1)

Step-by-step explanation:

The first term is ...

  A(1) = 5

The common difference is ...

  d = 8 - 5 = 3

Then the desired formula is ...

  A(n) = A(1) +d(n -1)

  A(n) = 5 +3(n -1)

(Find common denominator first.)
3/2 + b=7/4

Answers

Answer:

b = 1/4

Step-by-step explanation:

Take the given fractions : 3/2 and 7/4 and find a common denominator.

We will use 4 as a common denominator.

In order for the denominator of 3/2 to get to 4, you need to multiply by 2.

3 × 2 = 6        2 × 2 = 4

New fraction: 6/4

Now we have the equation 6/4 + b = 7/4

7/4 - 6/4 = 1/4

Please help look at the picture

Answers

Answer:

The correct answer would be D

What kind of solution does 3x+5=-2 have?

Answers

Answer:

[tex]x = - \frac{7}{3} [/tex]

step by step:

3x+5=-2

move constant to the right-hand side and change it's sign

3x=-2-5

Calculate the difference

3x=-7

Divided both sides of the equation by 3

Seven less than one-fourth of a numer is -1.

Answers

Answer:

The number is 24.

Step-by-step explanation:

-1+7=6

6*4=24

I believe the answer is 96

x/4 - 7 = 17

x/4 = 24

x = 96______is the number

2. The table shows distance, y, that Mario runs in x minutes.

Mario’s Running Speed

Time,

(min) Distance,

(mi)

7 | 1

21 | 3

35 | 5









(a) Based on the information in the table, write an equation that can be used to model the relationship between the time (x) and distance (y). Show your work.

(b) What is the rate of change for this linear relationship? Show your work.

(c) What is Mario’s distance given that he ran for 70 minutes? Show your work.

Answer:

Answers

Assuming the left is minutes and the right is distance, Mario runs 1 mile in 7 minutes
(a) y=x/7
(b) the rate of change is 7
(c) if he ran for 70 minutes then his distance is 10 miles.
*for (c) just plug in the number given. Replace it with x and divide it by 7.*

Does the table show a proportional relationship, if so , what is the value of y when x is 10

Answers

the table does show a proportional relationship, and the value of Y when X is 10 would be 3 1/3.

Yes, the given table shows a proportional relation with constant of proportionality  1/3.

What are proportional relation?

Two variables x and y are in proportional relation if the relation between  then is in the form y = k x, where k is the constant of proportionality.

Or we can say for all pairs ( x, y ) , y/x = k , k is constant then the table containing (x, y) values shows a proportional relationship.

From given table

When x= 5 , y =[tex]1\frac{2}{3}[/tex] =5/3

Then, y/x = (5/3)/5 = 1/3 =k

When x =6 , y =2

Then, y/x = 2/6 = 1/3 =k

When  x =  7 , y = [tex]2\frac{1}{3}[/tex] = 7/3

Then, y/x = (7/3) /7 = 1/3 =k

When x=8 , y =[tex]2\frac{2}{3}[/tex] = 8/3

Then , y/x = (8/3) / 8  = 1/3 =k

Thus for each pair (x, y) given in the table the ratio y/x is same , this ratio is say k = 1/3

Therefore, for the given table y/ x = k or y =k x with k = 1/3 , and the table  shows a proportional relation with constant of proportionality  1/3.

Also, Learn more about proportionality constant from the link below:

https://brainly.com/question/17793140

#SPJ2

It there sufficient evidence to conclude that more than 75% of US businesses monitor employees web site visits? Test the appropriate hypotheses using a significance level of 0.01

Answers

Complete question is;

In a survey of 565 U.S. businesses, 430 of these companies indicated that they monitor employees' web site visits. For purposes of this exercise, assume that it is reasonable to regard this sample as representative of businesses in the United States.

Is there sufficient evidence to conclude that more than 75% of U.S. businesses monitor employees' web site visits? Test the appropriate hypotheses using a significance level of 0.01. (Round your test statistic to two decimal places and your P-value to four decimal places.)

Answer:

There's not sufficient evidence to suggest that more than 75%  of U.S. businesses monitor employees website visits.

Step-by-step explanation:

Population proportion; p^ = 430/565 = 0.761

Sample proportion; p = 75% = 0.75

Significance level; α = 0.01

Sample size; n = 560

Let's define the hypotheses;

Null hypothesis; H0: p = 0.75

Alternative hypothesis: p > 0.75

Formula for the test statistic is;

z = (p^ - p)/√[p^(1 - p^)/n]

z = (0.75 - 0.761)/√(0.75(1 - 0.75)/560)

z = -0.011/√0.00033482143

z = -0.011/0.0183

z = -0.60

From online p-value from z-score calculator attached, using; z = -0.60, significance level = 0.01, one tailed hypothesis, we have;

P-value ≈ 0.2743

The p-value is greater than the significance level and so we will fail to reject the null hypothesis and conclude that there's not sufficient evidence to suggest that more than 75%  of U.S. businesses monitor employees website visits.

It rained all day on Mother's Day and the temperature dropped fourteen and seven tenth degrees. The next day the rain stopped and the temperature rose ten and nine tenths degrees. If the temperature at the beginning of Mother's Day was sixty five and eight tenths degrees, what was the temperature at the end of the day after Mother's Day?
PLEASE ANSWER< I WILL GIVE YOU BRAINLIEST

Answers

Answer:

62 Degrees

Step-by-step explanation:

65 8/10 - 14 7/10 = 51 1/10

51 1/10 + 10 9/10 = 62

As of July 1, 2014, the population of India was about 1,267,000,000. How can you write this number in scientific notation?
1. Move the decimal point to the right of the first digit. What is the first factor?

Answers

Answer:

1) 1.267x10^9

2) 2

Step-by-step explanation:

136 = -8(1 + 6v)
Help

Answers

Use distributive property
136 = -8 + -48v
-8 - 48v = 136
Add 8 to both sides
-48v = 144
Divide both sides by -48
v = -3

Answer:

-3

Step-by-step explanation:

136 = -8(1+6v)

136 = -8 - 48v

136 + 8 = -48v

144 = -48v

144/ -48 = v

-3 = v

Other Questions
Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg