Doctors and nutritionists use BLANK as a screening tool to assess weight in adults. They generally make further assessments to determine the amount of body fat that the person actually has.

Answers

Answer 1

Answer:

BMI

Explanation:

Answer 2

Answer:

BMI

Explanation:

Got it correct on my assignment


Related Questions

A client being discharged from the hospital to home with a diagnosis of tuberculosis is worried about the possibility of infecting family members and others. Which information should reassure the client that contaminating family members and others is not likely?

Answers

The options of this question are missing; here are the options:

Which information should reassure the client that contaminating family members and others is not likely?

A. The family does not need therapy, and client will not be contagious after 1 month of medication therapy

B. The family does not need therapy, and the client will not be contagious after 6 consecutive weeks of medication therapy

C. The family will receive prophylactic therapy, and the client will not be contagious after 1 continuous week of medication therapy

D. The family will receive prophylactic therapy, and the client will not be contagious after 2 to 3 weeks of medication therapy

The answer to this question is D. The family will receive prophylactic therapy, and the client will not be contagious after 2 to 3 weeks of medication therapy.

Explanation:

Tuberculosis is a serious contagious disease. Due to this, in tuberculosis treatment, the purpose is not only to stop the infection but to prevent this spreads to others. Indeed, the treatment for tuberculosis includes a set of medicines that stop the infection in the patient, which takes several weeks to end the infection; however, after 2 or 3 weeks the patient should not be contagious. Besides this, the family of the patient or anyone who has close contact with the patient should receive prophylactic therapy or medicine to prevent the development of the disease.

If a nutrient does not have a Tolerable Upper Intake Level, this means that: Group of answer choices it is safe to consume in any amount. insufficient data exist to establish a value. no caution is required when consuming supplements of that nutrient. it is safe when supplemental levels are added to foods.

Answers

Answer:

The correct option is;

Insufficient data exist to establish a value

Explanation:

The upper intake level is the maximum amount of the nutrient that can be taken without the likelihood of harmful side effects on the health of an  individual within the population. Taking nutrients above the stipulated upper intake level is likely to lead exposure to risk harmful side effects

Upper intake level have not been developed, however, for many nutrients due to lack adequate data as such it has been advised to apply extra caution to avoid adverse effects caused by excessive intake of such nutrients.

Patrick has shoulder impingement syndrome. He has been referred to you by a physical therapist for strengthening of his shoulder complex and to begin first with a closed chain exercise. Which progression is MOST appropriate

Answers

The available options are:

a) Push-up plus off a wall → shoulder IR/ER → seated DB press

b) Shoulder IR/ER → push-up plus → seated DB press

c) Shoulder IR/ER → seated DB press → push-up plus

d) High-rep bench press → shoulder IR/ER → abdominal crunch

Answer:

A. Push-up plus off a wall -> shoulder IR/ER -> seated DB press

Explanation:

A push-up plus off a wall is an example of a closed chain exercise as the arm is fixated to a stationary surface.

It also make your shoulder blades to move freely, making serratus anterior stronger, a vital muscle that keeps scapula stable and helps it rotate upward. This in turn reduces shoulder impingement when push-ups plus off a wall is done.

Shoulder IR/ER also helps to correct the imbalance in the rotator muscles of the shoulder.

Also, seated DB press strengthens all muscles of the shoulder in a functional way.

hair cells have a unique electrochemical gradient that, in a way, is very different from your average neuron. How so?
A. The amount of calcium is very high in the cell
B. sodium travels both directions
C. It uses GABA to depolarize it’s cilia
D. potassium is the positive charge carrier
E. sodium hyperpolarizes the cell

Answers

Answer:

A. The amount of calcium is very high in the cell

Explanation:

The electrochemical gradient of hair cells is directly related to the amount of calcium present in these cells. This is because these cells have a very high calcium concentration, causing constant leakage. These leaks are the main responsible for the release of the neutrotransmitters that will participate in the synapses.

In addition, this amount of calcium present in the hair cells is what makes these cells have an incredible speed in responding to mechanical stimuli, which makes all the difference within a biological system.

: Which of the following clinical signs of infection is indicative of sepsis? Bradycardia (less than 60 beats per minute) Leukopenia Body temperature above 101°F Tachypnea (more than 20 breaths per minute)

Answers

tachypnea is the answer

: Of the following, which is the most serious condition? Of the following, which is the most serious condition? ureteritis urethritis urethritis and cystitis cystitis pyelonephritis

Answers

cystitis pyelonephritis because the infection is in the kidney

19. You must always drive:
A. offensively.
B. defensively.
C. under the speed limit.
D. all of the above.

Answers

under the speed limit..we must be careful not to drive too fast.

C. Under the speed limit

A client appears very drowsy at bedtime and is difficult to arouse. The client is receiving halcion 0.25 mg PO at bedtime. Based on these findings, what would be the best nursing diagnosis for this client

Answers

Answer:

.125 may be the dosage this patient needs

A large medical practice that specializes in cancer care is weighing the advantages and disadvantages of implementing the most recent version of a commercial EHR or building its own homegrown system for its office. The staff selects a commercial EHR from a major vendor. Which factor best supports this decision

Answers

Hello. You forgot to enter the answer options. The options are:

a. A commercial product can be easily customized to accommodate the unique needs of the hospital.  b. A homegrown system cannot be certified by the Certification Commission for Healthcare Information Technology.  c. The commercial version is considered one of the "Best of Breed" products.  d. A homegrown system is typically interfaced with the organization's ADT system and downstream systems.

Answer:

c. The commercial version is considered one of the "Best of Breed" products.  

Explanation:

The commercial version is very expensive requiring a higher economic investment, than the investment that would be placed on a home system. However, the commercial version is considered "Best of Breed", that is, this version has an extremely superior quality which justifies its price and the more safety of its use, guaranteeing a very efficient and pleasant result. The domestic version may even work efficiently, but not in the same way as the commercial version.

An anxious client is admitted for treatment of an exacerbation of irritable bowel disease. The client asks the nurse if biofeedback will help after reading about biofeedback online. What is the best response by the nurse?

Answers

The available options are:

A.  "Biofeedback will help reduce stress."

B.  -"Biofeedback does not work for irritable bowel disease."

C.  -"Stress is hard to control and you may need a medication to relax."

D.  -"The device is just another expensive electronic toy."

Answer:

Biofeedback will help reduce stress.

Explanation:

This is because, research has shown that biofeedback is an evidence-based treatment for stress reduction. However, since, biofeedback is not a serious treatment, or is not indicated for the client's condition which is irritable bowel disease. Then it's expected that, the nurse should not tell the client that a medication for relaxation or biofeedback is the solution, but rather commend the client for reading and asking about the  efficiency of biofeedback.

Hence, the nurse should respond that, "Biofeedback will help reduce stress."

Anxiety is defined as the feeling of fear, uneasiness, and dread, which causes sweat, an increase in heart rate, and feeling tension. The client admitted for exacerbation of irritable bowel can be given biofeedback.

The correct answer is:

Option A. Biofeedback will help reduce stress

Biofeedback can be defined as:

1. Biofeedback is a type of technique used by medical professionals in which patients are taught to control some of the body's functions. In biofeedback, the patient is connected to the electrical sensors that help in receiving information about the body.

2. Biofeedback is an evidence-based treatment for stress reduction. Biofeedback can help in reducing stress by analyzing the conditions of the disease. It is not a cure and helps in managing the conditions of the disease.

Thus, the correct answer is Option A.

To know more about biofeedback, refer to the following link:

https://brainly.com/question/2837002

A primigavida who is a 38 weeks gestation calls the clinic stating she felt several contractions in her abdomen during the past hour she reports that the contractions were irregular and they decreased after she took a walk around the block. Based on this information , what is the health care provider's best response?

Answers

Answer:

It may be false contractions or real.The only way to know is for her to come in for an evaluation.

"A client diagnosed with bipolar disorder is getting ready to take her bar exam. She knows that if she stops taking her antipsychotic medication for several days she will then be able to stay up all night and study. She has done this before and has repeatedly been hospitalized for her bipolar disease. What term would the nurse use to describe the repetitive hospitalizations, followed by discharges, once back on her medications

Answers

Answer:

The patient is non-compliant.

Public health officials are concerned about a possible epidemic of methicillin-resistant Staphylococcus aureus (MRSA). It presents as a rapidly-progressing skin abscess accompanied by significant tissue destruction or "flesh-eating." Which condition has led to the concern that this disease may become an epidemic

Answers

overuse of antibiotics and bacteria becoming more resilient
overuse as well as self diagnosing and not finishing a full course of antibiotics

You are treating a 5-year-old child who has had severe diarrhea and vomiting for 3 days and is now showing signs of shock. Supplemental oxygen has been given and you have elevated his lower extremities. En route to the hospital, you note that his work of breathing has increased. You should:

Answers

start an IV for fluid resuscitation and put his on a heart monitor
Iv and a heart monitor

pls help I need someone to write a peace offering letter to my brother because I broke his play station because I kept dying in Mortal Kombat. Please make sure you have the word 'sorry' in it -- will give Brainliest

Answers

Answer:

- I am sorry ... for breaking your playstaion. I know this is hard to cope with but this was very hard for me to tell you. I was getting very upset with losing the game i got out of control and broke the playstaion. I know this comes with a price and trust me I will do anything to make sure you canf get a new one. Once again im sorry

Explanation:

Dear, (insert brother's name)

I'm very sorry for breaking your beloved play station, I know how much you care for it. I promise that I'll never cause any harm on it again. I hope you can understand where I'm coming from and know how dangerous losing continuously really is.

Hope mom will pay for a new one,

Your sibling.

how is that ion channels that let in positive charge could hyperpolarized a hair cell?

A. they feature unique residues that allow positive charge to go both directions
B. their ligands let out potassium ions, creating a negative electrochemical gradient
C. their ion channels are partially open at a resting state, and so closing them reduces the positive charge going into the cell
D. Ion channels that bind inverse agonist will reverse active ion transport, but only in the axon Hillock, leading to hyperpolarization down the axon

Answers

Answer:

B. their ligands let out potassium ions, creating a negative electrochemical gradient

Explanation:

A ciliated cell would be hyperpolarized by the action of positive ion kennels, when that cell received an inhibitory stimulus and the action of these channels allowed its ligands to release potassium ions (K +) and allow the entry of chlorine ions (Cl-), creating a negative electrochemical gradient, since the interior of the cell will have a negative potential greater than the external environment, which will be more positive. The result of this is to inhibit the spread of an action potential in the cellular environment.

The nurse instructs an obese 22-yr-old man with a sedentary job about the health benefits of an exercise program. The nurse evaluates that teaching is effective when the patient makes which statement?

Answers

it would be great if i can get up every hour or two from my desk and take a quick walk around the office s and stretch

emergency medical technicians are sometimes told to speak in the lower voice when responding to older patients, why is this?

A. lower voice sound sound more authoritative
B. The eardrums of older people are heavier and do not vibrate as well to high voices
C. conductive hearing loss typically begins in high frequency hair cells
D. lower frequencies require higher sound pressures according to the Fletcher Munson curve
E. sensorineural hearing loss typically begins in high frequency hair cells

Answers

Answer:

Option E

sensorineural hearing loss typically begins in high-frequency hair cells

Explanation:

In presbycusis, most old people cannot hear the high-frequency sounds, because of some loss of hair cells in their cochlea. unlike some other vertebrates like fishes and reptiles, these hair cells can be re-generated. However, in Humans, they cannot be.

As a result of these sounds that have higher pitches such as the buzzing of a mosquito, are muffled to them. Therefore, talking in a frequency is necessary, as this will aid the old people hear the medical technicians better.

There are 25 minerals that our bodies need to function properly. True or False

(FITNESS PLEASE HELP ILL MAKE A NEW QUESTION AND GIVE 30 POINTS AND BRAINLIEST TO THE PERSON WITH THE RIGHT AWNSER)






i wont really

Answers

False, there are 13-16 minerals out bodies need to funciton properly

According to research, what is the relationship between dietary carbohydrates and body weight? a. People who eat a diet rich in carbohydrate-dense root vegetables are more likely to have a high body weight. b. As people in other countries adopt "Western"-style diets, they lose weight. c. When body weight is taken into account, no significant link is found between higher sugar intakes and higher blood pressure d. Added sugar intake is most strongly linked with body weight in people with type 2 diabetes. e. Added sugars provide many of the excess calories that cause weight gain among U.S. adults.

Answers

Answer:

e. Added sugars provide many of the excess calories that cause weight gain among U.S. adults.

Explanation:

According to research study in the United States, which is also corroborated by the United States Centers for Disease Control and Prevention, shows that people from aged 6 years and above, consumed about 14% of total daily calories from added sugars which can lead to weight gain and obesity.

Hence, it was concluded that, the relationship between dietary carbohydrates and body weight is that "added sugars provide many of the excess calories that cause weight gain among U.S. adults."

4
.
1. In what region of the country would you expect
this patient to live?
Iren by people who

Answers

he visited to Zoo every week and to what the animal Tilak was also a message to discover the soul at a collection of animals at home to get to dog and baby owl and baby monkey one evening Sudheer brought the

On a visit to the family physician, a client is diagnosed with a bunion on the lateral side of the great toe, at the metatarsophalangeal joint. Which statement should the nurse include in the teaching session?

Answers

This question is incomplete because the options are missing; here is the complete question:

On a visit to the family physician, a client is diagnosed with a bunion on the lateral side of the great toe, at the metatarsophalangeal joint. Which statement should the nurse include in the teaching session?

A. "Bunions are congenital and can't be prevented."

B. "Bunions may result from wearing shoes that are too big, causing friction when the shoes slip back and forth."

C. "Bunions are caused by a metabolic condition called gout."

D. "Some bunions are congenital; others are caused by wearing shoes that are too short or narrow."

The answer to this question is D. "Some bunions are congenital; others are caused by wearing shoes that are too short or narrow."

Explanation:

Bunions are bumps or deformities that form in the joints of the toe, which can cause pain and swelling in the zone. Additionally, in terms of causes, the development of bunions is the result of either congenital factors (abnormalities from birth) or environmental factors, especially the friction and pressure caused by shoes that are short or narrow. Besides this, bunions can be treated through different options depending on symptoms which include medicines, shoe inserts, and surgery. According to this, option D explains the causes of bunions and it is ideal to include in a teaching session about this condition.

A client is preparing to have an operative procedure with general anesthesia. What statement made by the client should the nurse refer to the anesthesiologist immediately because it indicates risk for malignant hyperthermia

Answers

i had a family member die from anesthesia before

As I open a bottle of carbonated water, and lets out a distinctive whistling sound. where, in this spectrogram, would the whistling sound likely have occurred?
A. 0.1 secs
B. 0.4 secs
C. 0.55 secs
D. 1.1 secs

Answers

Answer:

Option D

1.1 seconds

Explanation:

The whistling sound has a high frequency and a high pitch. This is usually represented by a spike in the frequency-time graph.

The spectrogram is able to show this point on the graph it plots. This will be a point that has the waveforms clustered together as well as increased. These are points of high frequency, as well as pitch.

From the spectrogram, such a point occurs at point D.  at 1.1 seconds.

According to current dietary recommendations, trans fat intake should be limited. How is this best accomplished? a. Select foods containing manufactured rather than naturally occurring trans fats. b. Read labels to select foods that say "polyunsaturated fatty acid free." c. Avoid all processed foods such as bakery items, packaged cookies, and store-bought bread. d. Use fat replacers, such as olestra, which provide the same nutrient content as regular fats without being saturated. e. Choose foods with <10% of calories from saturated fat per serving and no hydrogenated oils in the ingredients list.

Answers

Answer:

The correct option is;

c. Avoid all processed foods such as bakery items, packaged cookies and store-bought bread

Explanation:

Dietary trans fat comes primarily from consuming processed bakery foods and packaged items such as crackers, cakes, cookies, margarine, popcorn, potato chips, fried potatoes, breakfast cereals although the frying process does not form the trans fat

80% of the dietary trans fat come from processed food or oils while the remaining are found in natural food sources

Limiting the consumption of processed foods which make up the 80% source of dietary trans fat is the most effective way of reducing trans fat intake.

1) Difference between health and Medicine

Answers

Answer:

The biggest difference between public health and medicine is that public health deals with the health from the perspective of populations, while medicine deals with health from the perspective of individuals. In medicine, the patient is the individual person

A person is trying to follow the best diet to reduce the risk of developing chronic disease. She wants to make sure that she consumes adequate nutrients in the best proportions from the foods she selects. Which would be the best Dietary Reference Intakes (DRI) standards for her to use to ensure she has the best energy nutrient intakes to reduce chronic disease risk? a. Daily Values (DV) b. Adequate Intakes (AI) c. Acceptable Macronutrient Distribution Ranges (AMDR) d. Recommended Dietary Allowances (RDA) e. Estimated Average Requirements (EAR)

Answers

Answer:

c. Acceptable Macronutrient Distribution Ranges (AMDR)

Explanation:

If the person is serious about best energy nutrient intakes they should consult with the Acceptable Macronutrient Distribution Ranges (AMDR)

AMDR lists range of nutrient intakes from different food categories and a widely used list by nutritionists as this list has been approved and reviewed by scientific authorities across the globe. It was originally issued by The Food and Nutrition Board of the Institutes of Medicine.

Here's the guidelines:

Carbohydrate (45%-65% of energy), Protein (10%-35% of energy)Fat (20%-35% of energy) [limit saturated and trans fats]

The information about guidelines was derived from the Pubmed article "Exercise and the Institute of Medicine recommendations for nutrition" which you can view on PubMed. I cannot include the link as the post might get deleted for containing links.

A hospital client's health status has declined sharply, and a referral to palliative care has been made. A nurse has suggested a referral to spiritual care, but a colleague states, "That is not likely necessary because the client's health record states 'no religion.'" How should the nurse best respond to the colleague's statement

Answers

we should allow the patient to chose

An elderly man who was stabbed several times has a puncture wound in the left anterior chest walls in the region of the fourth or fifth rib. There is minimal bleeding from the chest wound. The initial blood pressure reading was 120/70 mm Hg, but dropped to 102/86 mm Hg. This is an example of:

Answers

Answer:

Hypovolemic. Shock

Explanation:

Excessive blood loss causes a drop in blood pressure. This is called hypovolemic shock.

Lucille is a 4-year-old who has never visited a dentist, even though her family has dental insurance that allows for free regular check ups. Her parents say that they will start taking her to the dentist when her first permanent tooth erupts. What should her parents know about the advisability of delaying dental care

Answers

Answer:

Delaying dental care for a 4 year old girl is very bad because she have to know more about what a dentist is called and how to be able to take care of her teeth.

Other Questions
India and Pakistan have long disputed which country should have control over Kashmir because ? Plz help mw 8 am so dumb lol #Write a function called "in_parentheses" that accepts a #single argument, a string representing a sentence that #contains some words in parentheses. Your function should #return the contents of the parentheses. # #For example: # # in_parentheses("This is a sentence (words!)") -> "words!" # #If no text appears in parentheses, return an empty string. #Note that there are several edge cases introduced by this: #all of the following function calls would return an empty #string: # # in_parentheses("No parentheses") # in_parentheses("Open ( only") # in_parentheses("Closed ) only") # in_parentheses("Closed ) before ( open") # #You may assume, however, that there will not be multiple #open or closed parentheses. #Write your function here! def in_parentheses(a_string): import re regex = re.compile(".*?\((.*?)\)") result = re.findall(regex, a_string) return(result) #Below are some lines of code that will test your function. #You can change the value of the variable(s) to test your #function with different inputs. # #If your function works correctly, this will originally #print (including the blank lines): #words! # #as he is doing right now # # #! print(in_parentheses("This is a sentence (words!).")) print(in_parentheses("No parentheses here!")) print(in_parentheses("David tends to use parentheses a lot (as he is doing right now). It tends to be quite annoying.")) print(in_parentheses("Open ( only")) print(in_parentheses("Closed ) only")) print(in_parentheses("Closed ) before ( open")) print(in_parentheses("That's a lot of test cases(!)")) parts of the middle east have a mediterranean climate. this means they have hot, dry summers and warm, ____ winters what word completes the sentence The diversity committee at State U. is a long-standing committee with a stable membership. During the first meeting of the year, Sam, a relatively new member of the group, asks, "What are the plans for fall orientation?" Given that the group has a high-context culture, which of the following is the most likely response to Sam's question?a) We will have a special meeting at the end of the month to brainstorm ideas. We will appoint a subcommittee to draw up a schedule and deadlines for tasks, and proceed from that schedule.b) We will probably do the same thing we did last year.c) We will need to consult with the students who will be involved to get their input before we proceed. Then we can work on making a schedule and setting deadlines.d) That is the next thing on our agenda. Let's get busy deciding on a schedule, activities, and deadlines. Can someone help me with this one too John's lyrics are somewhat autobiographical and introspective on this '65 song that features brilliant harmonies throughout and lyrics that offer help to the forlorn listener. It is... Which two statements best describes the purpose of the passage ? please Evaluate ( 8/3) to the 2 power A). 8/9 B). 64/9 C). 64/3 D). 55 Line CD passes through points (0, 2) and (4, 6). Which equation represents line CD? Which of the following was true when Truman met Stalin in Potsdam in 1945? A.Their two nations were already enemies The war in the Pacific was still being fought. Britain had decided not to join them. World War II had ended. Please Help asap!!! Please give explanation If the price of biscuit per packet increased from N250 to N500 and the quantity bought per week decreased from 300 to 200 packets, determine the elasticity of demand for biscuit. Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes.