Describe the relationship between a and b that will make value of the expression 7 x a/b to 7

Describe The Relationship Between A And B That Will Make Value Of The Expression 7 X A/b To 7

Answers

Answer 1
a and b should be equal or the same digit. for example 5x2/5+5 or 2/2, because that equals 1. 7x1 is 7, therefore, a and b should be equal/same

Related Questions

Zoey goes to a store an buys an item that costs x dollars. She has a coupon for 15% off, and then a 9% tax is added to the discounted price. Write an expression in terms of x that represents the total amount that Zoey paid at the register.

Answers

Answer:

0.9265x

Step-by-step explanation:

x - 0.15x + 0.09(0.85x)

x is the initial amount, -0.15x is subtracting 15% of the original amount (leaving 0.85x), and 0.09(0.85x) is the 9% tax.

Simplified:

x - 0.15x + 0.09(0.85x)

= 0.85x + 0.0765x

= 0.9265x

0.9265x is The answer hope it helps

Jane can buy 3 bags of candy for her class of 25 children. If she has to buy candy for the combined classes which has a total of 65 children, how many bags of candy will Jane have to buy?

Answers

8 bags because you get 7.8 but you can’t buy .8 of a bag so you round up.
8 round up and there you go!

How do I divide whole numbers by fraction? (Ex: 12 ÷ 1⁄2)

Answers

That would be 6 just put the the whole number over one and keep flip change
It would be 1/24 because you turn the 12 into 12/1 then flip it to be 1/12 the multiply the 1/12 by the 1/2

In the picture. Plz help

Answers

Answer:

The answer is b) -3, -25

Step-by-step explanation:

A vertex on a graph is the trough of the deepest point.

Leroy is a sales person. He sold a crystal vase for $203 and earned 13% commission. How much commission did Leroy earn?

Answers

Answer:

For the vase, 26.39

Step-by-step explanation:

203*13%=26.39

the answer is 26.39 to ur question

Which proportional relationship has the greatest rate of change?

Answers

Answer:

Maybe C because 0 is equal to 0 and 2 is equal to 8 so they are multiplying each number by 4

It’s D i believe D is going up and it’s not constant.

help me ;v; and thank you sm!

Answers

27 Cm² (C)

...............

Answer:  Choice C.   27 cm^2

==========================================================

Explanation:

It's not directly stated, but I'm assuming that there's symmetry going on in terms of the triangle on the left being a mirror copy of the triangle on the right. If that assumption is true, then we have another "3 cm" along the bottom edge. In total, the bottom edge is 3+6+3 = 12 cm long.

The top edge, parallel to the bottom one, is 6 cm. We'll denote the two parallel sides to be the base lengths and we could write [tex]b_1 = 6 \text{ and } b_2 = 12[/tex]. The small subscript just helps us differentiate between the two base lengths.

The height is the vertical dashed line of 3 cm. This means h = 3. The height is always perpendicular to the base.

We'll plug those three variables into the area of a trapezoid formula below

[tex]A = \frac{h*(b_1+b_2)}{2}\\\\A = \frac{3*(6+12)}{2}\\\\A = \frac{3*(18)}{2}\\\\A = \frac{54}{2}\\\\A = 27\\\\[/tex]

The area is 27 square cm

-----------------------------------

Another way to get the answer is to break the trapezoid into three pieces: two triangles and a rectangle in between.

One triangle has an area of base*height/2 = 3*3/2 = 9/2 = 4.5 square cm, which means two triangles combine to an area of 2*4.5 = 9 square cm.

The rectangle has area of length*width = 6*3 = 18 cm^2

The trapezoid's area is the combination of what we found: 9+18 = 27 cm^2

Solve for x.



−2/3(3x−4)+3x=5/6




x=−19/6 ​

x=−11/6 ​ ​

x=21/6 ​

x=29/6

Answers

Answer:

X = 11/6

Step-by-step explanation:

Answer:

b) x = -11/6

Step-by-step explanation:

Given equation,

→ (-2/3)(3x - 4) + 3x = 5/6

Now the value of x will be,

→ (-2/3)(3x - 4) + 3x = 5/6

→ (-6x + 8)/3 + 3x = 5/6

→ (-6x + 8 + 9x)/3 = 5/6

→ -6x + 8 + 9x = (5/6) × 3

→ 3x + 8 = 5/2

→ 3x = (5/2) - 8

→ x = (-11/2) × (1/3)

→ [ x = -11/6 ]

Hence, value of x is -11/6.

plsplspslpslplspslpslsplsplsplsplsplspsl

Answers

i believe the answer is 28.27, or 28.3

16. The graph shows the relationship between the
cost of renting a bounce house and the number
of hours for the rental
200
180
160
140
Total Cost ($)
120
100
80
60
40
20
1 2 3
4 5 6
7 8 9 10
Hours
Which function best represents the relationship
shown?
A. y = 2x + 1
B. y = 20x + 2
C. y = 40x + 20
D. y = 20x + 40

Answers

$680 is the answer...........
680........,,.,,,,....,..,.

What is the fewest number of people surveyed if exactly 93.6% of people completed a survey?
Use the whole numbers 0 through 9, at most one time, to fill in the boxes to create an accurate
number line.

Answers

Answer:

Step-by-step explanation:

7

the fewest number of people surveyed is 125, i’ll explain why.

the percentage of people that finished the survey is 93.6%, given.

this percentage as a fraction is p, (being the people) = 93.6/100, so, p = 93.6/100.

you then multiple the fraction 93.6/100 by 10, which is: p = 936/1000. then, reduce the fraction.

p = 117/125.

the fraction can’t be reduced any further, so that’s your answer.

hope this helps!

PLS HELP NO LINKS AND CAN YOU PLS PUT AN EXPLANATION

Answers

Answer:

I believe it is 562 because if you subtract the cell phone bill balance from the cash balance you get $749-$187=$562

Step-by-step explanation:

im not sure this is 100% correct

29 POINTS TO WHOEVER GETS THIS RIGHT

What is the value of the expression below when w=7 and x=5
3w + 10x

Answers

Answer:

3 × 7 = 21

10 × 5 = 50

21 + 50 = 71

Therefore, the answer is 71.

Answer:

41

Step-by-step explanation:

Please awnser 4,5,8 its math btw

Answers

8. Determine the ratio just be dividing 4/3 and then times that by the amount of apples you have 15*1.3 = 20 bananas. Another way to think of it for every 3 apples you have one extra banana so when you have 15 apples you would have 5 extra bananas
4. the amount of O+ donors to the amount of O- donors.
5. the amount of B+ donors to the amount of A- donors. :))

b) Calculate the area of the window using the dimensions given in Part A. Show your work and explain your reasoning. (4 points)

Answers

Answer: (15.2 + 11.2) x (8.4/2) = 110.88

Step-by-step explanation:

Hope this helps :)

ASAP PLEASE HELP ILL GIVE BRAINLIEST!!

Answers

Answer: A=2 B= 1.75

Step-by-step explanation:

The figure shows a parallelogram inside a rectangle outline: A parallelogram is shown within a rectangle. The length of the rectangle is 3 over 4 foot and the width of the rectangle is 1 over 2 foot. The two equal bases of the triangles outside the parallelogram are labeled 1 over 8 foot. What is the area of the parallelogram? 1 over 32 square foot 5 over 16 square foot 9 over 32 square foot 6 over 16 square foot

Answers

Answer=5/16 or 0.3125 feet

Step-by-step explanation:

please show on a graph so i can understand pleaseeeee

Answers

Answer:

Step-by-step explanation:

then you find the lcm of 7, multiple by 6^999 and divide by 4. Take your remainder and multiply by 3/4, then take your product and take it to the 6th power.

That is a graph what you show in question what do you need

Hi come get the points and brainliest Theawm

Answers

my second account Theawp lol

Answer:

ok

Step-by-step explanation:

A credit card company charges 17% interest on any charges not paid at the end of the month. In February, $14.45 was paid in interest. How much of the charges were not paid at the end of the month? A. $31.45 B. $245.65 C. $69 D. $85

Answers

Answer:

D

Step-by-step explanation:

it’s $85, option D.

Which angles are supplementary to each other?

Answers

Answer:

8 and 5 and 8 and 13

Step-by-step explanation:

Answer: I should measure first but I can not because it is an image but I leave you the explanation of how to do

Step-by-step explanation: Two angles are complementary if the sum of their degrees is equal to 90º (ninety degrees). For example: a 30º angle and a 60º angle are two complementary angles. Since 90º is the measure of a right angle, another way of saying that two angles are complementary is that together they form a right angle

The y-coordinate of the vertex of the function y = 2x^2-8x+c is 2. The value of c is...

No links please

Answers

Answer:

i am not sure but tried .

[tex]c=y-2x^{2} +8x[/tex]

Step-by-step explanation:

The value of c would be 16.

Please help with this question..

Answers

Answer: I don’t know

Step-by-step explanation:

but I’m really broke

Answer:

(9 - v)^7 ?

I'm kinda confused

Need help 8th grade math

Answers

The third answer down is correct

Answer:

D

Step-by-step explanation:

What are numbers that cannot be divided by 5 without a remainder?

Answers

105, 275, 315, 420, 945, 760

Hope this works

105,275,315,420,945,760

Only answer if you know the correct answer! Thanks! :)

Answers

Answer:

1. A

2. C

3. D

4. B

What’s the question??

Leon pays $12.50 per month for a music subscription service.
One month he also buys 6 songs from the service. Each song
costs the same. His bill for that month is $17.84. In dollars, how
much does he pay for each song?

Answers

Answer:

$0.89

Step-by-step explanation:

17.84 - 12.50 = 5.34

5.34/6 = 0.89

Note: Enter your answer and show all the steps that you use to solve this problem in the space provided.


Use familiar figures to find the area of the figure shown. Show all work.

Answers

What he said ^^^^ that should be the right answer

Help..? As soon as possible please tysm :>

Answers

Answer:

A. The constant ratio of y/x is 12/5

Step-by-step explanation:

The ratio of y to x is constant which is 12/5. Hence option A is the correct option.

What is a constant?

The term "constant" has several meanings in mathematics. When used as a noun, it can have any of the following two meanings:  a constant, clearly defined number or another immutable mathematical object.

Given table is

x                 y

5/6             2

25/6          10

125/6        50

625/6      250

When x = 5/6 and y = 2:

x/y = (5/6)/2 = 5/12

∴y/x = 5/12

When x = 25/6 and y = 10:

x/y = (25/6)/10 = 25/60 = 5/12

∴y/x = 5/12

When x = 125/6 and y = 50:

x/y = (125/6)/50 = 125/300 = 5/12

∴y/x = 5/12

When x = 625/6 and y = 250:

x/y = (625/6)/250 = 625/1800 = 5/12

∴y/x = 5/12

To learn more about ratio, click on the below link:

https://brainly.com/question/5232821

#SPJ1

a snack-sized bag of M&M's contains 5 green, 6 yellow, 8 blue, and 7 brown. What is the probability of pulling out a blue one

Answers

Answer:

38%

Step-by-step explanation:

8 out of 21 is 38

It is 38 pls give brainliest
Other Questions
Cultural differences that might influence the guest service experience include all of the following except diet greetings humor marriage What was the Selective Service Act and how did it impact the war? When considering the various resources factors of production which of the following is most likely to represent capital? Find the area. The figure is not to scale You can NOT have an in group without having an out group True False 3 chairs and 4 tables cost rs 7540. if the price of a chair is 220 find the price of table?ans - 7120 two equivalent ratios for 17:5? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA The table below shows information about how many fans there were at twofootball matches in a local tournament.What is the difference between the number of away fans at the semi-final and atthe final?Semi-finalFinalTotal number of fans250400Ratio of home fansto away fans6:47:3 Follow the constitution and the law even if I disagree with it what power or duty is this listed on Nika rolls an 8-sided cube with faces numbered 1 through 8. Which of the following statements is true? P(even number) = P(odd number) = P(number less than 8) = 1P(the number 9) = 1 Why might Great Britain's colonies have contributed tothe start of Ine Industrial Revolutionin Great Britain? What is irony What are the 3 types of irony and examples of each? Which question is a statistical question?A. How tall is the oak tree?B. How much did the oak tree grow in one year?C. What are the heights of the oak trees in the schoolyard?D. What is the difference in height between the oak tree and the pine tree? HELP FOR MY FINAL PLEASE PLEASE In a random sample of 70 people, it was found that 44 of them were fans of the New York Yankees. What is the margin of error for the true proportion of all individuals who are fans of the New York Yankees? A. 0.0088 B. 0.058 C. 0.063 D. 0.116 E. 0.173 Which sentence is the most formal?A. Hi! Do you have any job openings at your work yet?O B. I would like to apply for the administrative position at yourcompany.C. I think it would be really fun to work at your company.D. Please hiring my person for the open position you got in yourestablishmentLIDT TCS the scrum team is using the KANBAN board to make work visually availible to all. What cannot be inferred from the board You can find Maya Angelou's many poetry volumes in most bookstores. What word or phrase is modified by the prepositional phrase in this sentence? What statements about prisms are always true if the top base is directly above the bottom base? Select all that apply. The lateral faces are rectangles. The bases are congruent. The bases can be any shape. The lateral faces are congruent.