Cellular respiration begins with Glycolysis, in which an investment of 2 ATPs are needed in order to break a carbon-carbon bond in 1 glucose molecule. When the bond is broken, high energy electrons are released and carried by ___________ to go to the Electron Transport Chain. The resulting carbon compound, pyruvate, will enter the Krebs Cycle. A net gain of 2 ATP are created. However, if oxygen is not readily available to the cell (and the mitochondria), ____________ and pyruvate will enter Lactic Acid Fermentation to free up the ____________ so it can continue accepting high energy electrons from the breakdown of glucose in Glycolysis. This will, in turn, continue to create a small, but steady supply of ATP energy.

Answers

Answer 1

Answer:

1. NADH

2. NADH

3. NADH

Explanation:

Cellular respiration begins with Glycolysis, in which an investment of 2 ATPs are needed in order to break a carbon-carbon bond in 1 glucose molecule. When the bond is broken, high energy electrons are released and carried by NADH to go to the Electron Transport Chain. The resulting carbon compound, pyruvate, will enter the Krebs Cycle (to produce GTP/ATP as well as NADH and FADH₂ which carries electrons to the electron tranport chain). A net gain of 2 ATP are created. However, if oxygen is not readily available to the cell (and the mitochondria), NADH and pyruvate will enter Lactic Acid Fermentation to free up the NADH so it can continue accepting high energy electrons from the breakdown of glucose in Glycolysis. This will, in turn, continue to create a small, but steady supply of ATP energy which is the 2 ATP generated in the payoff phase of glycolsis.


Related Questions

Electrophysiological cell-recording studies have indicated that the _______ may be especially important in the control of internally guided motor sequences, whereas the _______ may be especially important in the control of externally guided motor sequences. A. supplementary motor cortex; premotor cortex B. premotor cortex; supplementary motor cortex C. cerebellum; basal ganglia D. basal ganglia; cerebellum

Answers

Answer:

A. supplementary motor cortex; premotor cortex

Explanation:

The supplementary motor cortex, also known as the supplementary motor area (SMA), is an area of the cerebral cortex located anterior to the premotor cortex. This area (SMA) is involved in the execution of complex and rapid sequential movements (e.g., typing). Moreover, the premotor cortex is an area of the motor cortex located between the primary motor cortex and the prefrontal cortex. This area (premotor cortex) is activated during motor tasks including, among others, spatial and sensory guidance of movement.

5 countries with Very low undernourishment

Answers

Answer:

NIGERIA

AFGHANISTAN

CHAD

TIMOR-LESTE

MADAGASCAR

Explanation:

Nigeria
Afghanistan
Chad
Madagascar
Timor- Leste
:))

how does geosphere effect the rock cycle?​

Answers

Hydrosphere and Atmosphere: The erosion of rocks, a major part of the rock cycle and change in the geosphere over time, turns rock into sediment and then, sometimes, to sedimentary rock. ... Different combinations of sedimentary rocks form in environments with different climate conditions.


Question 4
Blood sugar homeostasis plays an important role in our health and well-being. If
blood sugar levels get too low or high, there are serious health complications that
can result. Which two body systems regulate blood sugar levels? Click on the correct
answers.

Select 2 correct answer(s)

A-Nervous System
B-Musculoskeletal System
C-Respiratory System
D-Digestive System

Answers

Nervous and digestive system

The diagram shows part of an aquatic food web
for a stable lake ecosystem in Connecticut.
Turtles
Large fish
Small fish
Aquatic insects
Tadpoles
Water fleas
Rotifers
Algae
What is the source of energy for the algae?
A waves
B. sunlight
C. bacteria
D. rotifers, water fleas and tadpoles

Answers

Answer:

Sunlight

Explanation:

I just got it wrong because of the wacko below or above me gave me the wrong answer

Algae possess chlorophyll in their cells. They use carbon dioxide in a manner that is analogous to how we use food. Thus, option B is correct.

What is a characteristic feature of algae?

By converting light energy to chemical energy through the process of photosynthesis, carbon dioxide and water are transformed into organic molecules.

Nearly all algae engage in the process, and in fact, much of what is currently known about photosynthesis was first uncovered through research on the green alga Chlorella.

Like other plants, algae benefit from sunlight, therefore denying them of it will limit or even completely stop their growth. For several days, completely shading the tank or aquarium from light is essential.

Therefore,  algae require sunshine because algae can photosynthesize, or use sunlight to change carbon dioxide into biological material.

Learn more about algae here:

https://brainly.com/question/13921782

#SPJ2

 True or False: If two organisms are located near one another on a phylogenetic tree they share a recent common ancestor.

HELP ILL MARK BRAINLIEST!

Answers

Answer:

True

Explanation:

When are the two organisms that share the most common ancestor in the tree 1. the sequence of branching does not necessarily indicate the actual (absolute) ages of the particular species 2. we cannot assume that a taxon on a phylogenetic tree evolved from the taxon next to it (just bc two species are located near each other does not mean the are more clostly related)

“Phylogenetic relationship” refers to the relative times in the past that species shared common ancestors. Two species (B & C) are more closely related to one another than either one is to a third species (A) if, and only if, they share a more recent common ancestor with one another (at Time 2) than they do with the third species (at Time 1).

I believe the answer is true

Which adaptation is most likely found in tropical trees?

Answers

Answer:

birds and squirrels

Explanation:

Answer:

The leaves of forest trees have adapted to cope with high rainfall. Many tropical rainforest leaves have a drip tip. It is thought that these drip tips enable rain drops to run off quickly.

Hope this helped!!!

Name two types of a sexual
reproduction which occur in animals
giving one example in each case​

Answers

Answer:

Meiosis and Fertilization

sexual and asexual reproduction

Some evidence on the safety of vaccines.

Answers

Answer:

The safety an​d effectiveness of vaccines​ are under constant study. Because vaccines are designed to be given routinely during well-child care visits, they must be extraordinarily safe. Safety testing begins as soon as a new vaccine is contemplated, continues until it is licensed, and is monitored indefinitely after licensure.

Explanation:

Answer:

well

Explanation:

Before a vaccine is ever recommended for use, it’s tested in labs. This process can take several years. FDA uses the information from these tests to decide whether to test the vaccine with people.

During a clinical trial, a vaccine is tested on people who volunteer to get vaccinated. Clinical trials usually start with 20 to 100 volunteers, but eventually include thousands of volunteers. These tests can take several years and answer important questions like:

Implantation Which of the following sequences correctly describes prenatal development? A. blastocyst implants in uterus, zygote forms, heart begins beating, lungs can breathe air, sex organs become visible B. blastocyst implants in the uterus, zygote forms, heart begins beating, sex organs become visible, lungs can breathe air C. zygote forms, blastocyst implants in the uterus, heart begins beating, sex organs become visible, lungs can breathe air D. zygote forms, blastocyst implants in the uterus, sex organs become visible, heart begins beating, lungs can breathe air 3. Which of the following correrti​

Answers

Explanation:

A because in the pental development the men and women sex others for there fun and baby in this ara

List and describe three methods of nonpoint pollution control.
1.
2.
3.

Answers

Answer:

1. Protect drinking water by using less pesticides and fertilizers.

2. Reduce soil erosion by using conservation practices and other applicable best management practices.

3. Use planned grazing systems on pasture and rangeland.

Type _ blood is the universal donor
Type _ blood is the universal recipient

Answers

Answer:

Type O- blood is the universal donor

Type AB- blood is the universal recipient

Type O negative is universal donor
Type AB positive is the universal receiver

Question 1 of 5
What is one way water moves through the nonliving parts of an ecosystem
during the water cycle?
A. Transpiration
B. Evaporation
ОООО
C. Photosynthesis
D. Sweating

Answers

i think it is B
explanation: water droplets or anything comes from the ground and goes up in into the clouds to create evaporation which then fills the clouds to make it rain.

The energy needed for the changes in the water cycle to take place comes
from__.
A. wind
B.green plants
C.nitrogen
D.the sun

Answers

It’s D. I got it right lol

How might we predict whether their next child will show the trait of albinism?

Answers

Answer:

By taking the baby to a doctor so that they can doi testing to see if you child has problems or heathy

Explanation:

The baby might need some shots

Bacteria Natural Selection

Answers

Answer:

Bacterial resistance arises through the simple process of natural selection. Bacteria divide rapidly, but DNA replication is imperfect. In the presence of antibiotics, while most bacteria are killed, a small number of resistant mutants may survive and take over.

Explanation:

When bacteria are initially exposed to an antibiotic, those most susceptible to the antibiotic will die quickly, leaving any surviving bacteria to pass on their resistant features

Newyork is near 40 degrees N. What general direction is air moving in Newyork

Answers

Answer:

The air in New York moves to the north.  

Explanation:

At a global level, it occurs unequal warming of the atmosphere, which depends on many factors and varies with latitude. These temperature differences occur because solar radiation reaches the earth differently at different latitudes degrees. The result is the formation of convective cells of atmospheric air circulation: Hardley cell, Ferrel cell, and Polar cell.    

The term convective cell refers to air getting warm, expanding, getting less dense, and ascending. During ascension, it gets colder because of the change in high, contracting, becoming thicker. Finally, it descends.

In each hemisphere, warm air ascends at the equator and approximately at 60º latitude. Cold air descends at approximately 30º latitude and the poles. These air masses circulation generates superficial winds that blow toward the equator between 0º-30º, and toward the poles between 30º-60º lat.  

Ferrel cell occurs between 30º and 60º latitude. At 30º lat, the cold air coming from the north in the tropopause meets the cold air coming from 0º, and both descend to lower altitudes due to its density and low temperature. When these air masses reach the ground, they diverge.  One part goes to 0º lat, while the other part goes forward to the north.  As it moves north, it gets warmer for being at lower altitudes. At 60º, this warm air coming from the 30º meets the polar air coming from 90º, and as it is warmer it ascends again. When it ascends to the tropopause, it is pushed by new air and moves to the south again. While doing so, it loses heat and becomes denser, descending again at 30º.  And so the cycle starts all over again. New York is located at 40º latitude approximately, so air goes forward to the north pole near the ground, but at 60º it elevates again. New York is then affected by the Ferrel cell.        

In the attached image you will find the three cells, circulating in different directions.  

Which components bond with andenine in a section if double stranded DNA

Answers

Answer: 3 and 5 only

Explanation:

Adenine is a purine nitrogenous base and it pairs with thymine which is a pyrimidine nitrogenous base with a triple hydrogen bond in a DNA structure. The adenine binds with thymine directly and indirectly with a deoxyribose sugar which is attached with it in the back it forms the part of sugar phosphate backbone and in the front hydrogen bonding helps in the stabilizing the DNA structure by binding two separate strands of DNA in a stable double helical structure.

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

3. Compare and contrast the movement produced by each of the three types

Answers

Answer:

strike-slip is when the blocks have mostly moved horizontally, normal is when a dip-slip fault in which the block above the fault has moved downward relative to the block below, and thrust is when the hanging wall moves up relative to the footwall.

There are three faults. Normal faults originate from the divergent boundary. Reverse faults originate from the convergent boundary. Strike-slip fault originate from transforming boundary.

What are the three types of fault?

We can differenciate three types of faults,

Normal fault ⇒ originate from divergent movementReverse fault ⇒ originate from convergent movementStricke-slip fault ⇒ originate from transforming movement

What are the boundary types?

I. Divergent:

This boundary occurs when two plates separate and molten material rises from the mantle creating a new crust.

The hot material creates a new seabed between the separating plates, expanding the sea bottom.

II. Convergent.

Collision area between two plates. Two oceanic plates might collide, or one oceanic plate with a continental one.

In this last case, the oceanic crust sinks under the continental plate, and magma rises to the surface by crevices.

The thicker and older plate subduces under the other plate.

III. Transforming.

The plates slide laterally with each other, and they are usually called faults.

It is associated, in general, with the oceanic ridge, although it might also occur in the continental plate.

No rocky material is either destroyed or formed.

When the plates move and produce a displacement of one transforming limits from side to side, earthquakes occur.

The movement breaks the crust and originates pronounced fractures.

You can learn mor about the movement produced by the three types of faults at

https://brainly.com/question/8548987

https://brainly.com/question/15441752

#SPJ2

Which sequence shows a correct pathway for the
flow of energy in a food chain?
A) bacteria → grass → fox → owl
B) grass grasshopper → frog - snake
C) fungi - beetle → algae - mouse
D) algae → snake → duck → deer

Answers

I think is B because the grasshopper is eaten by the frog and the frog is eaten by the snake.

The sequence grass →  grasshopper frog →  snake shows a correct pathway for the flow of energy in a food chain (Option B).

In a food chain, primary producers (e.g., plants and algae) generate organic compounds and energy that enter into the chain.

The primary consumers (e.g., herbivores) are organisms that eat primary producers.

Subsequently, secondary consumers (e.g., carnivores) are organisms that eat primary consumers and so successively in all the levels.

In conclusion, the sequence grass →  grasshopper frog →  snake shows a correct pathway for the flow of energy in a food chain (Option B).

Learn more in:

https://brainly.com/question/16065961

How is the ocean affected by the releasing of excess carbon?

Answers

Answer:

Explanation:

Because of human-driven increased levels of carbon dioxide in the atmosphere, there is more CO2 dissolving into the ocean. The ocean's average pH is now around 8.1 , which is basic (or alkaline), but as the ocean continues to absorb more CO2, the pH decreases and the ocean becomes more acidic.

15. Cells found in plants and animals have similarities but can differ in function. Consider the following two organisms: a corn plant cell (Zea mays) and a camel cell (Bactrianus ferus). What is the best explanation for the difference in the cellular vacuole size between these two biotic organisms?

A. The corn cells' have a small vacuole size because it does not need long term water and
electrolyte storage.

B. The camel cells' have a small vacuole size because it does not need long term water and electrolyte storage.

C. The camel cells' have a small vacuole size because it is not in contact with toxins that need to be removed from the cell.

D. The corn cells' have a large vacuole size because it is in contact with many toxins in the soil which need to be removed from the cell.

Answers

The best explanation for the difference in the cellular vacuole size is option d. The corn cells' have a large vacuole size.

Explanation to the difference in the cellular vacuole size:

When there is the difference in the vacuole size that lies between the two biotic organism so it is due to the corn cells that contain high vacuole since they are in contact with various toxins in the soil that need to be eliminated from the cell.

hence, the correct option is d.

And, the rest of the options are wrong.

Learn more about cell here: https://brainly.com/question/14568392

PLEASEEEE HELPPPPPPPPPPP
Professor Marcus has identified a new species of beetle in the Amazon Rainforest. The professor then investigates the process of gene expression in the cells of the beetle. Which is an expected result of the investigation?

A The processes of transcription and translation are unique in the beetle.

B The process of translation in the beetle is similar to other organisms, but involves a unique genetic code.

C The process of transcription in the beetle is similar to other organisms, but involves a unique set of nucleic acids in mRNA.

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Answers

Answer:

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Explanation:

Transcription is the cellular process where a specific DNA fragment called 'gene' is used as a template to create a complementary RNA molecule, usually a messenger RNA (mRNA). Subsequently, this mRNA is then used to synthesize a polypeptide chain (i.e., a protein) in the ribosomes. In eukaryotic organisms such as, in this case, beetles, both transcription and translation are essentially the same processes, and the genetic code used in the protein synthesis is also the same. The difference between beetles is the variation among DNA nucleotide sequences (genomes) which are used as templates to synthesize mRNAs, thereby their final products (proteins) are also different.

help me with this page pls

Answers

Answer:

1. Industrial

2. Industrial and transportation

3. Coal

4. Oil

5. Oil

6. Coal and natural gas

This confuses me, but I believe it is the answer. Don't rely on this answer too much, though.

State one important precaution regarding the apparatus used in all food tests​

Answers

Answer:

WEAR A LAB COAT TO PROTECT YOUR CLOTHES AGAINST THESE CHEMICALS, AND SAFETY GLASSES TO PROTECT EYES, UNLESS YOU ARE A SPECTACLE WEARER. (EXCEPT WET GLASSWARE, AND EMPTY CHEMICAL BOTTLES!). BE ESPECIALLY CAREFUL WITH HOT LIQUIDS AND WATERBATHS. KEEP CHEMICAL BOTTLES OFF THE BENCH, AND DO NOT CONTAMINATE PIPETTES

Explanation:

HELP...ill give brainliest! PICTURE ATTATCHED!!!!!!

Answers

Answer:

D I think is the answer

what are the two effects of world war one?

Answers

Answer:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

Explanation:

The First World War leads to destruction of empires. Numerous new nation-states were created. United States were forced to become a world power that in turn lead to the rise of Hitler and Soviet communism.

Effects of world war one are as follows:

1. Loss of almost an entire generation of young men by Europe.

2. Nationalism raised in the colonial empires

True or False?

It takes about the one million years for
the magma to complete one circular
convection flow.

Answers

Answer:

False, since it takes more than one million years

Explanation:

Speeds can be faster for small-scale convection occurring in low-viscosity regions beneath the lithosphere, and slower in the lowermost mantle where viscosities are larger. A single shallow convection cycle takes on the order of 50 million years, though deeper convection can be closer to 200 million years.

Don’t understand need help

Answers

Answer:

I think c

Explanation:

I took the quiz but I m not sure

Other Questions
simplify this answer pls How did Alexander Graham Bells invention of the telephone affect the telegraph? A massive flood tears out many trees in a wooded area. What would you expect the area to look like a year later? A. A new species of trees will be about half grown. B. Grasses and weeds will be growing in the sunny areas. C. It will look exactly like it did before the flood. D. There will not be any plants growing the first year. find the missing side round to the nearest tenth. 3. What is the mass % of a solution that contains 36g KCl in 475g of water? What is the value of 7, 488 / 416 Which statement best describes the form of comedy known as vaudeville?A. It depends on audience participation.B. It's filled with deeper meanings.C. It's performed purely for laughs.D. It relies on complex, elaborate plots. 5. chris is a school teacher who earns $32,000 for the 10-month school year. however, the salary is paid out in 12 monthly installments. how much does is the monthly paycheck? _________ The Santa Fe Trail started in Missouri. Where did it end?NowHampshireMaineVermontOregonTerritoryMinnesotaTerritoryWisconsinMichiganUnorganizedterritorylowaOhioinois IndianaMexican Cession(Unorganized territory)MissouriNowYorkRhodeIslandPennsylvania ConnecticutNew JerseyocDelawareVirginiaWayland(D.C. - Districtof Columbia)NorthCarolinaSouthCarolinaStasTerritoriesOther countriesKentuckyTennesseeddAlabama GeorgTexasFloridaLouisianaKingdom ofHawaiiRussian VERY EASY, WILL GIVE 50 POINTS FOR CORRECT ANSWER ASAP AND WILL GIVE BRAINLIEST. What is the median for the following set of data?5, 7, 9, 11, 13, 13A. 10B. 8C. 9D. 11 Identify five verbs of the simple past tense in the review What is the measure of x? How do you pronounce Aevico?A. Ay-Vak-OhB. Ah-Vi-SoC. Ay-Vick-OhD. Ah-Vic-OhGotem A clothing retailer is gathering data on the amount of time each customer spends shopping in its stores. Each location collected 20 pieces of data and will compile that data to determine a population mean. One location has a sample mean of 32.5.Which statement must be true about this situation?A. The population mean is also 32.5.B. There is not enough information to make a conclusion about the population mean.C. The population mean must be greater than 32.5.D. The population mean must be less than 32.5. Dominic made the table below to organize his notes about mixtures. A 1-column table. The first column labeled properties of mixtures has entries has no set composition, must have more than one state of matter, must have more than one substance. What mistake did Dominic make? A. The title should read Properties of Solutions because some mixtures do not have all of the properties listed. B. There is a definite recipe to make each mixture, so the composition of a mixture is set. C. Although it is possible to have more than one state, it is also possible to have only one state. D. A single substance can be used to make a mixture if the substance is composed of more than one element. Just want to confirm the answer is 4 more student because from 6 to 10 is 4More or Im wrong ?? Just please help me with yes or no thanks Can someone please answer these two questions HELP PLEASE ASAP!!!!! 20 POINTS!!!! De Kooning used subtle brushwork and an analogous color palette to create rhythm and harmony.De Kooning used aggressive brushwork and bold colors to create emotional, provocative imagery.De Kooning created convincing space that distinguished the figure from the background.De Kooning created a black and white under-painting first, and then layered patches of color on top