because there was no written record of the village history, the stories of the griots became the history and the only record of past events. Griots often kept records of
Group of answer choices

births and deaths

marriages

environmental events like droughts

all of the above

Answers

Answer 1
all of the above!!!! i just did this
Answer 2
I think all of the above

Related Questions

Lawmaking Process of Congress - How a Bill becomes a law. List the steps of how a Bill becomes a law. Step 1 - 7.

Answers

Answer:

first day of Representatives sponsors a bill. the bill is going to sign to a committee for study if released by the committee the bill is put on a calendar to be avoided or debated or amended if the bill passes by simple majority 218 of 435 the bill moves to the Senate

Very happy for you guys all in classroom meeting with you guys all week

The “New World” was an ideal place for the growth of representative government because-
A. Political philosophers such as John Locke and Montesquieu were settlers in the “New World”
B. Most settlers migrated to the “New World” to create a new form of government
C. The rulers of the “Old World” were too far away to oversee the issues of settlers in the “New World”
D. Settlers often had participated in representative governments in the countries they migrated from

Answers

Answer:

B. Most settlers migrated to the “New World” to create a new form of government.

Explanation:

This was the main reason people traveled to the new world.

The answer to this question is B

How and Where do Cultures differ?

Answers

Answer:

Cultures: describe several ways in which cultures can differ from one another Language, religion, cultural landscapes, social organization. In many cultures, social mobility is restricted, especially for women and minorities. Cultural differences are the various beliefs, behaviors, languages, practices and expressions considered unique to members of a specific ethnicity, race or national origin. Some examples of cultural differences as they pertain to the workplace include employees who are younger or older than their co-workers, etc.

Explanation:

What's something that you feel strongly about

(this is a civilized conversation zone, no all caps, no raised voices, no arguing, just conversation, be respectful of other people's opinions or views)

Answers

Answer:

LGBTQ+ community.

Explanation:

I think everyone can love who they wanna love and some people cant help that. You like who you like. Another is , be yourself. You're amazing , you're gorgeous , dont let others bring you down.

I feel that the death penalty should be abolished everywhere in the US. It's barbaric and there's no way to be absolutely sure everyone on death row is guilty of not.

How did the group of artists known as the Lost Generation feel about the Roaring Twenties?

Answers

Answer:  Feeling cynical about humanity's prospects, they rebelled against the values of their elders, seeking debauchery instead of decency, and hedonism instead of ideology.

Explanation:

What river connects the Great Lakes to the Atlantic Ocean?

Answers

The St. Lawrence river connects the Great Lakes to the Atlantic ocean.

Answer:

The St. Lawrence River

Explanation:

The entire lake system flows to the Atlantic Ocean via the St. Lawrence River.

How did the Battle of Lexington and Concord bring the colonists closer to war?

Answers

While the colonists lost many minutemen, the Battles of Lexington and Concord were considered a major military victory and displayed to the British and King George III that unjust behavior would not be tolerated in America. The battles also constituted the first military conflicts of the American Revolution.

While the colonists long monumental

What is the difference between an inhabited and uninhabited territory?


1: Inhabited territories have a permanent population, and uninhabited territories do not.

2: Uninhabited territories have a permanent population, and inhabited territories do not.

3: Inhabited territories are claimed by more than one country.

4: Uninhabited territories are claimed by more than one country.

Answers

Answer: 1

Explanation: look it up

plz help i ish a confuzzled smol bean uwu

Answers

Answer:

The answer is #1

its called Oregon Territory

Answer:

it's I no A- A#1

I hope it helps

have a great day

#Captainpower

Scientists measured the spot size of guppies (small fish) in two different populations. Which population has more guppies with large spots?

a. They both have the same number of guppies with large spots.

b. The population in Brazil has more guppies with large spots.

c. The population in Venezuela has more guppies with large spots.

d. These bar graphs do not show which population has more guppies with large spots.

Answers

Answer:

d???????????

Explanation:

How did the US support its allies prior to entering the war?
sent spies to find where enemy camps were located

established a war campaign fund for foreign troops

grew food to support soldiers

established the Lend-Lease Act

Answers

Answer:

in world war 2 they grew food for soliders

Answer:

grew food to support soldiers

Explanation:

trust me on this i did this question and got it right

Pls help !! What contributed to the idea that people have rights and that the power of government should be limited?

Answers

The Magna Carta, drafted in the year 1215, is one of the earliest pieces of evidence of a limited government. The document limited the reach of the English king's power by giving the country's nobility rights that they could exercise over the throne.

Answer:

It is D.

Explanation:

Hope this helps you.

Mesopotamia is compared to what other civilization?


GIVING BRAINLISEST UGH

Answers

The name Mesopotamia was given to the Middle Eastern civilisation that existed between the Euphrates and Tigris Rivers. ... The Middle East is mostly dry and sandy. However, Mesopotamia is different because the two rivers kept the land fertile through regular flooding of the area.

Ancient Egypt

Explanation:

Their way of problem solving and "culture" were very similar.

somebody help mehhhhhh

Answers

arbys we have the meats

Answer:

portugal and Brazil is the answer

Explain in which specific ways you are making good use of the time you have now.

Answers

Answer:

to make god use of your time you can do work you need to do spen time dooing a hobbie or even helping other people

Explanation:

Answer:

RIght now I am finishing up school work, and I will tidy up my house by picking up trash and doing laundry. This morning I did some 10 min yoga and got dressed and stuff but I havent eaten today so I will have some egg and yogurt (not together seprate) for brekafast. My dad is building a new shop so I took a picture of his progress today. I am also going to paint my nails bc I  have nothing else to do haha.

Explanation:

A civil suit always involves individual people. Civil suits can NOT be between companies or states.



True

False. (I'll give brainlest if you help me with this)

Answers

I am pretty sure this answer is false. Sorry if I couldn’t help have a great day.
its false, companies can sue each other for stealing a logo or something

write 3 to 4 paragraphs about how woman contributed to the to the american revulation

Answers

Answer:   Women served the war effort in other important ways, sewing uniforms and blankets for the soldiers, making bullets, and raising funds for the war effort. Many women who were left home to tend their husband's business affairs and property began to relish the extra responsibility and to view themselves as successful managers, thereby widening the scope of what was considered “women’s work.” Some women organized relief efforts to gather much-needed supplies for the soldiers. For instance, Esther DeBerdt Reed, the wife of George Washington's former secretary, organized a volunteer association for clothing the troops.

Explanation:

helllllllllllllllllllllpppppppppp

Answers

Answer:

Effect

Explanation:

Answer:

I believe it's all of them

Explanation: Limiting how often a citizen can drive their car can either be cause, effect, or a solution.

Why was Canada such a valuable property for England and France to fight over?

Answers

Answer:The British and French vied for control by courting local Native nations, but neither The war began with conflicts about land.  Today it is part of Canada. This was an important victory for the British and helped to raise the troops morale.

Explanation:

The French and Indian War was fought to decide if Britain or France would be the strong power in North America. France and its colonists and Indian allies fought against Britain, its colonists and Indian allies. The war began with conflicts about land. White people were destroying the Indians' hunting areas.
When Britain emerged as victorious when the treaty was signed, the British gained a lot of territories and North America was their’s and France had not won.

Hope this helped and have a nice day :)

Hope this helped and have a

The Great Wall of China was begun in the third century BCE, but most of the construction of the wall we see today was built during the Ming Dynasty from

A. eleventh century CE to twelfth century CE.
B. from sixteenth century CE to eighteenth century CE.
C. tenth century CE to thirteenth century CE.
D. fourteenth century CE to seventeenth century CE.

Answers

Answer:

D i'm pretty sure

Explanation:

Answer:

D

Explanation:

Math the questions with the letter. No links, downloads, or anything. Don't need to explain. Will mark brainliest.

Answers

Answer:

photo copy of answers

Explanation:

you just match things

How does Canada’s location on two oceans help it to be a leader in world trade?

Answers

Answer: Canada is uniquely located on three oceans: the Artic, the Atlantic, and the Pacific. These ports allow goods to be shipped into and out of Canada easily without having to travel through other countries.

The ocean brings rain and mild temperatures to western Canada. It provides a trade route from the west and is home to important Canadian fisheries.

HELPPPPPPPPPPPPPPPPP PLZZZZZZZZ

Answers

The Sistine Chapel ceiling, painted by Michelangelo between 1508 and 1512, is a cornerstone work of High Renaissance art.

How did the Norman rulers of Sicily treat the cultural groups living on Sicily?

Answers

Answer:

The history of Sicily has been influenced by numerous ethnic groups. It has seen Sicily ... The most significant changes that the Normans were to bring to Sicily were in the areas of religion, ... His greatest legacy was the building of the Cathedral of Monreale, perhaps the best surviving example of Siculo-Norman architecture

Explanation:

Define the word "cause"
20 points
a problem or event that brings change.
people working.
no change occurs.
all of the above

Answers

Answer:

the 1st option

Explanation:

A: a problem or event that brings change

Why were enslaved Africans brought to the Caribbean?

Answers

Answer:

Africans were forcibly brought to British-owned colonies in the Caribbean and sold as slaves to work on plantations. Those engaged in the trade were driven by the huge financial gain to be made, both in the Caribbean and at home in Britain.

Africans were forcibly brought to British owned colonies in the Caribbean and sold as slaves to work on plantations. Those engaged in the trade were driven by the huge financial gain to be made, both in the Caribbean and at home in Britain.

I NEED HELP ASAP I WILL GIVE BRAINLIESTS
Select the correct answer from each drop-down menu.

Sean is a citizen of Britain. He has joined an international ____ because citizens from any nation can become a member. The ____ is an example of such an organization.
1. peacekeeping organization, nongovernmental organization, government agency
2. Peace Corps, Red Cross, USAID

Answers

Answer:

ok so the first is peacekeeping

How many years after Father Hidalgo began the move to independence did Mexico actually break free of Spain?

Answers

Answer:

Date 16 September 1810 – 27 September 1821 (11 years, 1 week and 4 days)

Explanation:

Mexico exports 80% of all that it produces to the USA.
A. True
B. False

Answers

Answer:

pretty sure it is false

Explanation:

The answer is A. True

Will give brainliest for the correct answer
Where and when did Booker T. Washington make his famous speech through which he shared this belief?

Answers

Answer: On September 18, 1895, the African American educator and leader Booker T. Washington delivered his famous "Atlanta Compromise" speech at the Cotton States and International Exposition in Atlanta.

Explanation:

On September 18, 1895, the African American educator and leader Booker T. Washington delivered his famous "Atlanta Compromise" speech at the Cotton States and International Exposition in Atlanta.

Not to be rude but it might help to search it that’s how I got this answer ;)

But can I still get brainliest?
Other Questions
Removing Shingles from a roof is called aO tear OffO Removing ShinglesO Shingle ReplacementO Remodeling roofing what do you think is the meaning of road rage? A fine fabric was selling for $10.50 per half yard. Joni bought 2 1/3 yards. How much did he spend? Brainliest for correct answer. Need help plz i will give brainlyist no scammer i will report and i only have 5 min Find four arithmetic means between -8 and 17. Which statement is NOT a reason Rosa Parks was considered the right person to be the face of the Civil Rights Movement? a Rosa Parks was married and had a good job. b Rosa Parks bridged classes and was comfortable and accepted in many different social settings. c Rosa Parks had lived in Pine Level, so she was familiar with Claudette Colvins family. d Rosa Parks was an adult who was widely known in the community. e Rosa Parks was well-liked and known as level-headed in the community. Need help on his ASAP El____(ir) a la bibloteca giving brainliest *easy* Please help, test due in 2 hours! Will give good review and brainliest. Here are summary statistics for randomly selected weights of newborn girls: n=250, x_=32.9 hg, s=6.9 hg. Construct a confidence interval estimate of the mean. Use a 95% confidence level. Are these results very different from the confidence interval 31.9 hg < < 34.5 hg with only 19 sample values, x_ = 33.2hg, and s = 2.9 hg? what is the complementary DNA of TACCGGATGCCAGATCAAATC? notes of Vibrational Motion or what they are what is y=-x-4 if x=-2 Help meh plssssssss!!!!!!!! Where does Ivan Jakovlevitch findMajor Kovaloff's nose? Name and describe three types of internal medicine specialties. The base of a triangular pyramid has an area of 20 square feet. The height of the pyramid is 36 feet. The volume of the pyramid is 720 cubic feet Need answer quick please Determine if the data is biased or not biased: A shirt manufacturer wants to check quality control of their products. The plant manager decides to check every 5th shirt inspected by Inspector D. There are 15 inspectors in the plant. BiasedNot Biased