ASAP!!!A scientist designed an experiment to test where a plant's matter came from. She
measured the starting mass of a willow tree, the soil, and the container. After five
years, she repeated the measurements and observed that the tree gained 74 kg (164
lbs) but the soil had not changed much at all (only lost 57 g, approximately 0.12 lbs).
1. Use evidence, from the results, to explain that the idea that the mass of a tree
comes from the soil, is incorrect. 2 points
2. Why is it incorrect to say that the tree's mass comes from sunlight? 1 point
3. If the mass of the tree does not come from the soil or sunlight, explain the trees
increase in mass. 2 points

Answers

Answer 1

Explanation:

The fact that the soil did not change significantly after five years, while the tree gained 74 kg, suggests that the tree's mass did not come from the soil alone. If the tree had gained all its mass from the soil, the soil would have lost an equivalent amount of mass, which did not occur. Therefore, this evidence suggests that the mass of a tree does not come solely from the soil.

While sunlight is necessary for photosynthesis, which allows the tree to produce glucose, the mass of a tree does not come directly from sunlight. Rather, the tree uses the glucose produced during photosynthesis to build its own tissues, such as leaves, branches, and roots. Therefore, while sunlight is necessary for the tree to grow, it is not the source of the tree's mass.

The tree's increase in mass is primarily due to the process of photosynthesis. During photosynthesis, the tree uses energy from sunlight to convert carbon dioxide and water into glucose, which it then uses to build new tissues. Additionally, the tree may have also taken up nutrients, such as nitrogen and phosphorus, from the soil, which it incorporated into its tissues. However, it's important to note that the majority of the tree's mass comes from the carbon that it takes up during photosynthesis, rather than the nutrients in the soil.


Related Questions

compare the genetic makeup of the offspring plants that are transferred to the soil to that of the parent plant that provided the stem pieces

Answers

When plants reproduce through vegetative propagation (such as through stem cuttings), the genetic makeup of the offspring plants will be identical to the parent plant that provided the stem pieces.

This is because the offspring plants are essentially clones of the parent plant and inherit all of their genetic material from the parent plant.

In contrast, when plants reproduce sexually (through seeds), the genetic makeup of the offspring plants will be different from that of the parent plants. This is because sexual reproduction involves the fusion of gametes from two different parent plants, resulting in a new combination of genetic material in the offspring.

Therefore, when using vegetative propagation, the genetic makeup of the offspring plants will be identical to that of the parent plant, whereas sexual reproduction can result in offspring with different genetic makeup from the parents.

What is vegetative propagation?

Vegetative propagation is a type of asexual reproduction in plants in which a new plant is produced from vegetative parts of the parent plant, such as stems, roots, and leaves, without the involvement of seeds or spores. In this process, the new plant that is produced is genetically identical to the parent plant, which means that the offspring is a clone of the parent. vegetative propagation can occur naturally or through human intervention.

To know more about reproduction, visit:

https://brainly.com/question/14329745

#SPJ1

genotype that below indicate where is the heterozygous in AA

Answers

Homozygotes are people having the genotypes AA and aa (i.e., they have two copies of the same allele). Those who have the genotype Aa are heterozygotes (i.e., they have two different alleles at the A locus).

AA could be heterozygous?A gene region where there are two distinct alleles present. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype (compound heterozygote).This is true for polydactyly, achondroplastic dwarfism, and Huntington disease. Heterozygous (Aa) carriers are not healthy individuals. They are affected by the illness in the same way as homozygous dominant (AA) people. being completely normal.

For more information on heterozygous gene kindly visit to

https://brainly.com/question/15267972

#SPJ1

In dragons, blue horns
(B) are dominant to
yellow horns (b).
What percent of these
offspring would have
yellow horns?

50%
75%
0%
25%

Answers

The answer is 25 percent

What is the purpose of the digestive enzymes found in the synaptic cleft?

Answers

The synaptic cleft does not contain any digesting enzymes. Neurotransmitters are released into the synaptic cleft, a tiny space between neurons, to carry messages from one neuron to the next.

What function do enzymes serve in the synaptic cleft?

Certain neurotransmitters are broken down by synaptic enzymes, which are found in the synaptic cleft. A synapse is the junction of two neurons where neurotransmitters carry information.

In the synaptic cleft, what enzyme is present?

A type-B carboxylesterase enzyme called acetylcholinesterase is largely found in the synaptic cleft, with a minor amount being present in the extrajunctional region. The muscle secretes acetylcholinesterase, which is kept bound to it by collagen linked to the basal lamina.

To know more about synaptic cleft visit:-

https://brainly.com/question/6346282

#SPJ1

If given: two solutions separated by a semi-permeable membrane. One side is 15% solute and the other is 30% solute. In what direction will water move?

Answers

Answer: Water will likely move to the 30% side to balance out the substance.

Explanation: In osmosis, water always move to wherever there is more solutes so that the solution is balanced out with an equal amount of solutes on both sides of the semi-permeable membrane.

-. Two genes-pointy-ness of chin and pointy-ness of nose-have the following
alleles: P = pointy chin, p = round chin, N = round nose, n = pointy nose. A man
with a pointy chin and pointy nose mates with a woman with a round chin and
ound nose and produces a child with a pointy chin and round nose. What are all
he possible genotypes for this child?


2. Inhumans, short fingers (F) and widow's peak (W) are dominant over long
ingers (f) and straight hairline (w). A heterozygote for both genes reproduces
with a similar heterozygote. What is the chance of any one child having the same
phenotype as the parents?

Answers

The possible genotypes for the child are: Pn and pn from the descriptions in the question.

What are the possible genes?

To determine this, we can use a Punnett square. The man has the genotype PPnn (pointy chin and pointy nose), and the woman has the genotype ppNN (round chin and round nose).

The offspring genotype possibilities are PNn, PnN, Pnn, and pnn. However, we are told that the child has a pointy chin and a round nose, so the only possible genotypes for this phenotype are Pn and pn.

Therefore, the child could have the genotype Pn (pointy chin, round nose) or pn (round chin, pointy nose).

Learn more about genes:https://brainly.com/question/8832859

#SPJ1

06. A deer population increases in size from 2000 to 2300 individuals over one year. Calculate the growth rate of the population during this time interval. (3mks)​

Answers

Answer:

15%

Explanation:

(2300 - 2000) / 2000 = 15%

steps

To calculate the growth rate of the deer population during this time interval, we need to use the following formula:

Growth rate = (final population size - initial population size) / initial population size

Plugging in the given values, we get:

Growth rate = (2300 - 2000) / 2000

Growth rate = 0.15 or 15%

Therefore, the growth rate of the deer population during this time interval is 15%

chatgpt

A gene is a segment of DNA that determines all of part of a trail. How does the nucleotide sequence of a gene compare
to that of an entirely different gene ?

Answers

Answer:

Explanation:

The nucleotide sequence of a gene can be very different from the nucleotide sequence of an entirely different gene. Each gene has a unique sequence of nucleotides that determines the specific instructions for making a particular protein or RNA molecule. The sequence of nucleotides in a gene determines the order of amino acids in the protein or the sequence of bases in the RNA molecule. This sequence of nucleotides can vary widely between different genes, even within the same organism. However, there may also be similarities or conserved regions between genes that encode similar proteins or have similar functions, indicating a shared evolutionary history. In general, the nucleotide sequence of a gene is specific to that gene and is distinct from the nucleotide sequence of any other gene.

Need help on this question please

Answers

The key effect of the drugs that treat Polycythemia Vera (PV) is the process of DNA transcription. Option B

What is the target of the drugs?

Polycythemia Vera (PV) is a myeloproliferative disorder characterized by the overproduction of red blood cells, white blood cells, and platelets. The primary target of PV drugs is to reduce the production of these cells and prevent complications such as blood clots, which can cause stroke, heart attack, and other serious problems.

The most commonly used drugs for the treatment of PV are hydroxyurea and interferon alpha. Hydroxyurea works by inhibiting DNA transcription.

Learn more about Polycythemia Vera:https://brainly.com/question/29492784

#SPJ1

Site-specific recombination is catalysed by:


DNA polymerase


Integrases


Gyrases


Topoisomerases

Answers

Answer: B

Explanation:

Site-specific recombination is catalyzed by integrases.

Which of the following is true of food deserts?

Urban areas with public transportation do not have food deserts.

As long as food is accessible, the location is not considered a food desert.

Low-income residents in rural areas do not face the same obstacles.

Food deserts are often found in low-income areas that lack traditional grocery stores.

Answers

The statement "Food deserts are often found in low-income areas that lack traditional grocery stores" is true.'

What are food deserts?

Food deserts are areas where people have limited access to affordable and nutritious food, especially fresh fruits and vegetables. This often occurs in low-income areas where there are no grocery stores or other food retailers that offer healthy food options.

Food deserts can be found in both urban and rural areas, and access to public transportation may not necessarily solve the issue. Low-income residents in rural areas may face additional obstacles in accessing healthy food options, such as transportation and distance to grocery stores.

Learn about food desert here https://brainly.com/question/27811160

#SPJ1

B. Mark True or False statements
4. If all seeds fall under the parent plant they will grow into very healthy plants.

Answers

False

If all seeds fall under the parent plant there will be storage of space for germination of seeds.

39. Imagine that you are at the local fitness center and see a bunch of girls from your school. So, you try to impress them by doing bicep "curls". What is the correct sequence for how your nervous system tells your
muscles to move and "curl" the weight?

1.motor neuron-brain-spinal cord-muscle
2. brain-spinal cord-motor neuron-muscle
3.muscle- motor neuron-spinal cord-brain
4.brain-motor neuron-spinal cord-muscle

Answers

The correct sequence for how your nervous system tells your muscles to move and "curl" the weight is:

Brain-spinal cord-motor neuron-muscle; option 2.

What is the correct sequence for how your nervous system tells your muscles to move and "curl" the weight?

The movement of the bicep "curls" is initiated by the brain, which sends a signal down the spinal cord to the motor neuron.

The motor neuron then transmits the signal to the muscles in the bicep, causing them to contract and move the weight.

This sequence of events is known as the motor pathway and is responsible for voluntary movement in the body.

Learn more about nervous system at: https://brainly.com/question/869589

#SPJ1


PLEASE HELP IM STUCK

Based on his pea-plant data, which three conclusions did Mendel reach? A. The alleles for a particular gene are inherited independently of each other. B. Parents pass some kind of factor to their offspring during reproduction. C. DNA is the substance that carries inherited information from parents to offspring. D. Dominant alleles mask recessive alleles.​

Answers

Based on his pea-plant data, Mendel reached the following three conclusions:

A. The alleles for a particular gene are inherited independently of each other.

B. Parents pass some kind of factor to their offspring during reproduction.

D. Dominant alleles mask recessive alleles.

Mendel did not know about DNA, as it had not yet been discovered. Instead, he referred to the "factors" that were passed down from parents to offspring. Later, scientists discovered that these factors are genes made up of DNA.

What is DNA?

DNA (Deoxyribonucleic Acid) is a molecule that carries the genetic instructions used in the growth, development, functioning, and reproduction of all living organisms and many viruses. DNA consists of a long chain of nucleotides, which are the building blocks of the molecule. Each nucleotide is made up of a sugar molecule (deoxyribose), a phosphate group, and a nitrogenous base.

The four types of nitrogenous bases found in DNA are adenine (A), thymine (T), cytosine (C), and guanine (G). The sequence of these bases along the DNA chain forms a genetic code that is responsible for the traits and characteristics of an organism. DNA is found in the nucleus of eukaryotic cells and in the cytoplasm of prokaryotic cells.

To know more about DNA, visit:

https://brainly.com/question/264225

#SPJ1

An organism has a total of 32 chromosomes. What is the organism's diploid number? ______ Haploid number ______

Answers

Answer:

16 hap rest

Explanation:

Unit 9 Study Guide - The Restless Earth Science. I NEED ANSWERS ASAP!!!!!!! PLEASE ANSWER!!! PLEASE HURRY!!!! PLEASE ANSWER ALL 21!!!! THERE ARE 21 QUESTIONS PLEASE ANSWER THEM ALL AS SOON AS YOU CAN!!!!!!!!!!!!!!!!!

Answers

The image is a graph showing the trend of global temperatures over the past century, based on data collected from various sources. The graph indicates that global temperatures have been steadily rising since the 1900s, with the past few decades showing a particularly sharp increase.

What is the graph's primary trend?

The main trend shown in the graph is the steady increase in global temperatures over the past century, with a particularly sharp increase in the past few decades. This trend is a cause for concern as it indicates that the Earth's climate is changing at an unprecedented rate.

What factors contribute to the increase in global temperatures?

The increase in global temperatures is primarily caused by human activities that release greenhouse gases, such as carbon dioxide, into the atmosphere.

These gases trap heat from the sun, leading to a warming effect on the Earth's surface. Other factors that contribute to the increase in global temperatures include deforestation, industrial activities, and transportation.

To know more about global temperatures,visit:

https://brainly.com/question/9089155

#SPJ1

Hemophilia is a recessive, sex linked gene. If a hemophilic woman and a nonhemophilic man have two boys and two
girls, will any of the children be hemophilic? With punnet square

Answers

Answer:

Yes, the two daughters will be carriers of the hemophilia gene. Although they may not show any symptoms of the disorder, they may pass it on to their offspring.

Which describes this landform?

anticline
shearing
syncline
tension

Answers

Answer:

since there is no picture we cannot help you but ive seen this question before with a picture and it was C. syncline

Explanation:

Answer: c. syncline

Explanation:

Transcribe and translate the following strands of DNA. Then answer the questions about protein synthesis.

1. DNA: TACCATCGATTGGAAGACCTTAACGAGCTAACT
mRNA:
amino acids:


2. DNA: CTGTTACTTTCAATCGTACACCAACACTGCTTTC
mRNA:
amino acids:

Answers

Answer:

so I don't know this one but will tell you how to solve it.

Explanation:

During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript (pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule (polypeptide) encoded by the original gene.

what fluid is found at the base of the petals

Answers

nectar. which is produced in glands called nectaries which are found at the base of flowers. hope this helps :)

3. The amount of nitrogen in the soil, water, and air have become unbalanced because
a. fish produce too many nitrates.
b. human beings have destroyed too many plants.
c. human beings use too many fertilizers.
d. human beings grow crops that don't use very many nitrates.

Answers

Nitrogen is actually considered the most vital thing for assisting plant growth. Nitrogen is part of the chlorophyll molecule, which gives plant life their green shade and is involved in developing food for the plant thru photosynthesis.

Lack of nitrogen indicates up as familiar yellowing (chlorosis) of the plant.

What are the fundamental motives of nitrogen loss from the soil?

Image end result for three The quantity of nitrogen in the soil, water, and air have turn out to be unbalanced due to the fact a. fish produce too many nitrates. b. human beings have destroyed too many plants. c. human beings use too many fertilizers. d. human beings grow crops that do not use very many nitrates.

Nitrogen can be misplaced from agricultural lands via soil erosion and runoff. Losses thru these occasions commonly don't account for a giant portion of the soil N budget, however should be regarded for surface water fine issues.

Learn more about nitrogen soil, water here;

https://brainly.com/question/20848502

#SPJ1

3. Circle the words that correctly complete the sentences.
•The individuals selected for breeding have certain traits, which are determined
by [alleles/engineering].
• The alleles for selected traits become [less/more] common in a population as
its genetic diversity [decreases/increases].

Answers

The individuals selected for breeding have certain traits, which are determined by alleles.

• The alleles for selected traits become [more] common in a population as its genetic diversity decreases

What are alleles?

Alleles are different versions of a gene that exist at the same location (locus) on a chromosome. Each individual inherits two copies of each gene (one from each parent), and therefore two alleles at each locus.

Alleles may differ in their DNA sequence, resulting in differences in the physical or functional characteristics of the trait they control. For example, the gene for eye color has different alleles that produce brown, blue, or green eyes.

The combination of an individual's alleles at a particular locus is known as its genotype, and the physical expression of the genotype is called its phenotype.

learn about Alleles here https://brainly.com/question/23516288

#SPJ1

30. What is the potential where a cell membrane must be more positive than negative to initiate an impulse?

A.action potential
B.stimulus
C.threshold potential
D.membrane potential

Answers

The threshold potential is the value at which a cell membrane must be more positively charged than negatively charged in order to produce an impulse.

Threshold potential

The threshold potential is a crucial depolarization level that must be attained in order for a neuron to initiate an action potential or nerve impulse.

Voltage-gated ion channels in the membrane of a neuron open when the membrane potential reaches the threshold potential, enabling an influx of positively charged ions into the cell.

The result is a fast depolarization of the cell membrane, which generates an action potential that travels the entire length of the neuron.

It's crucial to understand that the threshold potential varies depending on the kind and location of the neuron, in addition to other elements like temperature and the presence of toxins or medications.

learn more about impulse here

https://brainly.com/question/477839

#SPJ1

Definition: Meat extract, Yeast extract, Peptone (pepsic, tryptic and papainic), Agar-Agar ,gelatin Please help me necessary

Answers

Answer:

Explanation:

Meat extract: Meat extract is a concentrated meat stock that is made by boiling meat in water and then straining out the solids. The resulting liquid is then further processed to produce a thick, flavorful extract that is used as a base for soups, gravies, and other dishes.

Yeast extract: Yeast extract is a natural flavoring made from yeast cells that have been broken down using enzymes or heat. It is commonly used as a flavoring agent in soups, stews, sauces, and other savory dishes.

Peptone: Peptone is a complex mixture of amino acids that is produced by the partial hydrolysis of proteins. It is commonly used as a nutrient source in microbiology and biotechnology applications.

Agar-Agar: Agar-Agar is a gelatinous substance derived from red algae. It is commonly used as a gelling agent in food and pharmaceutical products.

Gelatin: Gelatin is a protein that is derived from collagen, which is found in the connective tissue of animals. It is commonly used as a gelling agent in food products such as jellies, marshmallows, and gummy candies.

Why are two primers necessary for pcr amplification to work?

Answers

Answer:Two primers are utilized, one for each of the complementary single strands of DNA released during denaturation. The forward primer attaches to the start codon of the template DNA (the anti-sense strand), while the reverse primer attaches to the stop codon of the complementary strand of DNA (the sense strand).

Explanation:

A)Structural adaptation of seeds
B)Economic and biological importance of seeds.

Answers

Answer:  A) Structural adaptation of seeds:

1. Sticky and feathery nature.

2. Float in water

3. Survive adverse conditions.

B) Economic and Biological importance of seeds:

1.  Rich in proteins, starch and oil reserves.

2. Used as a raw material in industries.

Explanation: A) Structural adaptation of seeds are as follows :

1. Stamens are sticky and feathery for those seeds in which pollination is done by air

2.Water pollinating seeds have hyaluronic layer that do not allows them to get wet in water and their light weight provides them strength to float in water.

3. Some seeds develop sporopollenin layer. which provides them strength to survive the adverse conditions.

B) Economic and Biological importance of seeds are as follows :

1. Some seed contains higher amount of protein content, starch content, oil reserves. which helps in the growth of the growing plants.

2. Seeds are also used in food and chemical industries as raw materials.

To learn more about Seeds:

https://brainly.com/question/29093380?referrer=searchResults

https://brainly.com/question/1343178?referrer=searchResults

Make a claim related to asthma and pollution. Provide data from your research and provide a reasoning to back up your claim.

Answers

Your lips or nose could let tiny airborne particles into your lungs. Air quality issues are caused by airborne particles, which include haze, smoke, and airborne dust.

Breathing in microscopic particles puts those who have asthma at more risk. Asthma symptoms may worsen as a result of the particles.

More than 23 million Americans suffer from asthma, a dangerous and potentially fatal chronic respiratory condition, which is connected to air pollution. Air pollution can exacerbate asthma symptoms and precipitate asthma episodes.

In order to lessen the health burden associated with the disease, EPA conducts research on the relationship between air pollution and asthma.

Learn more about asthma here:

https://brainly.com/question/8195337

#SPJ1

Do you think the adaptations of the animal you chose are a result of its environment, genes, or both? Explain your answer.

Answers

Answer:

The adaptations are result of both the environment and genes. Animal develop adaptive characteristics in response to their environmental challenges. These adaptations help the animals survive in their environment. The animals are more likely to reach reproductive age. So,these adaptive traits are more likely to be passed on to offspring.In the case of cheetahs,tan coloring,conservation of water, and fast legs are traits that help them survive in the savanna. These traits,like all the other characteristics of cheetahs,are genetically passed from parents to offspring.

Explanation:

if it helped you please mark me a brainliest :))

Label the following Diagram with the words given

Answers

(a) Sunlight, (b) photosynthesis, (c) chloroplasts, (d) sugar, (e) chlorophyll, (f) carbon dioxide, (g) cellular respiration, (h) mitochondria

Explain the process of photosynthesis?

Photosynthesis is the process by which green plants and other organisms use sunlight, carbon dioxide, and water to produce oxygen and glucose (a type of sugar). This process is essential for the survival of plants and other organisms that depend on them for food and oxygen.

It is a process by which plants, algae, and some bacteria convert light energy into chemical energy in the form of glucose. This process takes place in chloroplasts, which are organelles found in plant cells. The energy from sunlight is used to split water molecules into oxygen and hydrogen ions. The hydrogen ions are used to produce ATP, which is a type of energy currency for cells.

Carbon dioxide from the air is also taken up by the plant and used to create glucose through a series of chemical reactions. Glucose is then used by the plant for energy or stored as starch. In summary, photosynthesis is a complex process that enables plants to create their own food and is essential for life on earth.

Learn more about photosynthesis here:

https://brainly.com/question/29764662

#SPJ1

the relaxed pairing at the blank position of the codon and the blank position of the anticodon are blank and blank to follow the traditional base pair rules. this allows for a single trna to recognize multiple codons.

Answers

The relaxed pairing at the third position of the codon and the first position of the anticodon are wobble and able to follow the traditional base pair rules. This allows for a single tRNA to recognize multiple codons.

Relaxed pairing at the third position of the codon and the first position of the anticodon refers to the ability of the genetic code to tolerate non-standard base pairing between these positions during translation. Specifically, the third position of the codon (also known as the wobble position) can form non-Watson-Crick base pairs with the first position of the anticodon, allowing a single tRNA molecule to recognize and bind to multiple codons that differ only in this position. This phenomenon expands the coding capacity of the genetic code and helps to optimize the efficiency of protein synthesis.

To know more about protein synthesis

brainly.com/question/29763759

#SPJ4

Other Questions
What are the ICE immigration enforcement priorities? 5.prokaryotes in cow intestines produce more methane if the cow is fed a diet high in grains rather than grass. some scientists propose that overfeeding grain to cows contributes to global warming. how did these scientists arrive at this hypothesis, and how could it be tested? At the end of the year, Mercy Cosmetics balance of Allowance for Uncollectible Accounts is $400 (credit) before adjustment. The balance of Accounts Receivable is $15,000. The company estimates that 10% of accounts will not be collected over the next year. What adjustment would Mercy Cosmetics record for Allowance for Uncollectible Accounts? the section of the patent application that includes engineering specifications, materials and components is the: multiple choice background and advantage section. description of invention. claims section. executive summary. According to the article, what caused Alba Coln to change hercareer goals while in college?A. She was hired for a job with a NASCAR team.B. She took some fun classes in engineering.C. She attended training to be an astronaut.D. She took part in a competition to build a race car. Extras Measurements that are closely grouped around the mean are __________. What one word completes this sentence? Arielle prefers a job that brings steady and dependable income. Which of the following is she most likely to consider the greatest disadvantage to working in the hospitality and tourism industry?A) Many jobs in the industry offer employment on a seasonal basis.B) Many jobs in the industry require customer service and interaction.C) Some jobs in the industry have starting salaries on the low side.D) Some jobs in the industry may require employees to relocate. Earth is closer to the sun in December than it is in July. What happens to the orbital speed of the planet between July and December? Explain your answer how did the decision in this 1950 case benefit minorities? 3y + 7y -84 = 180 supplementary find the value for y How many hydrogen atoms are in 2.0 GH A rack of bowling balls behind John and Judys lane holds at least 6 bowling balls. Each of the bowling balls weights either 8 pounds or 16 pounds, and the total weight of the bowling balls on the rack is no more than 160 pounds. Assuming x represents the number of 8-lb balls and y represents the number of 16lb bowling balls, the system of equations below can be used to represent the situation(x+y>6) (8x+16y PLS SOMEONE HELP MEEEEE Solve the equation for the variable.2b^4 - 13 = 73=Enter your answers in increasing order, rounded to three decimal places.b =b = Argyle has 10 T-shirts and 7 pairs of shorts that he wears with either sandals or sneakers. If all the colors and patterns coordinate, how manydifferent outfits can he make? What is this cartoon stating about democracy? What is this cartoon stating about our First Amendment rights? a city has two water towers. one tower holds 4.37 x 106 6 gallons of water and the other holds 3.92 x 106 6 gallons of water. what is the combined water capacity of the two towers? responses worth 36 pointsssspls answer Solve for x or z in terms of the other variables. Maura is making beaded bracelets for her school's craft fair. To make a bracelet, she strings 25 beads along a 20-centimeter-long piece of elastic cord. If Maura bought a pack of 1,000 beads to make bracelets, how many meters of the elastic cord should she buy?