anyone need brainliest​

Answers

Answer 1

Answer:

Plzz give me brainiest I will also give you


Related Questions

1. Ian ......... a shower at the moment, so could you call back in about half an hour?
A) takes
B) is taking
C) has taken
D) has been taking
2. Eric, ........ hockey competitively or just for fun?
A) do you usually play
B) are you usually playing
C) have you usually played
D) have you usually been playing

Answers

1. a 2. b
that’s my answer but it says my response needs to be 20 words long so dkskskskwsssssssssdsdddd

Read the sentence from the text.

One day, a sick woman inspired Elizabeth to pursue a new goal.

What does the word pursue most likely mean in the sentence above?

A.
follow close behind

B.
create a change

C.
learn all about

D.
try to achieve

Answers

Answer:

The answer D is the most logical answer

While the plot diagram may look like a pyramid, it works more like a.?.

Answers

Answer:

The system involving the following:

peopletransportationetc.

Pls real answers please points You will revise one body paragraph from your informational article and write a reflection paragraph in which you explain the revisions you made.


View the grading rubric as you complete your work. This is your guide to a super submission.


Choose one body paragraph from your informational article to revise.

Copy this paragraph into a new document.

Review your paragraph for coherence. Make sure you have a topic sentence and supporting ideas for this topic.

Combine two or more sentences in your paragraph for varied syntax.

Review your paragraph for correct English language conventions. Correct any errors.

Write a short reflection paragraph on the revisions you made, describing the changes you made and how these changes improved your writing.


I don't have a paragraph so can someone please write a paragraph about jelly fishes it should have the problems that the animal causes, who it affects, and how the problems can be solved.
PLEASE HELPPPPPPPPPPP!!!!!!!!!!!!!!!!!!

Answers

Answer:

Jellyfish blooms, which were already bad enough, can even affect the political stability of a country. A power plant in the Philippines was shut off after the system was clogged by jellyfish and because of it, thousands of people were without electricity. The Philippine citizens were so upset that there was nearly a political upheaval in the country. What can be done about all these disruptions? These blooms affect many different countries and the effects are devastating.

(Is this good or do I need to explain because I am a little confused)

Answer:

Moreover, jellyfish blooms can even affect the political stability of a country. This is true because a power plant in the Philippines was shut off after the system was clogged by jellyfish, and because of it, thousands of people were without lights or electricity. The Philippine citizens were so angry that there was nearly a political upheaval in the country. What can be done about all these problems? These blooms affect many countries, and the effects are devastating. Not to worry, there are some possible solutions to these blooms. People have come up with ideas like eating the jellyfish or even getting a different species of jellyfish to eat the jellyfish that are causing these blooms.

I changed some of the words in my paragraph to make it my own and combined sentences to make the writing sound smoother. I even added more transition words and made sure to correct any errors in my punctuation.

Explanation:

Ok, so this is an add-on of what the other guy said, and stop hunting him down to finish his answer. (yeah i know you said, "yeah i'm talking about english don't act lik eyou forgot)

I tried, and if this isn't good enough, then try to work with it, and make it better.

Write the simple subject in the following sentence (her lucky pencil was missing from her case)

Answers

The subject would be her “lucky pencil”, but since it’s simple- it would just be her pencil.

How high quality products helps build loyal and trust between customer and brand?

Answers

Answer:

Brands can build trust by showing their “authentic” side and staying true to their stated values. Brands can build trust by focusing on “dependability” and boosting confidence that they can deliver their stated benefit

Explanation:

Which questions do adjectives answer about the words they modify? A. How many? B. What kind? C. Which one? D. all of the above​

Answers

Answer:

The answer is D.

Explanation:

Adjectives are parts of speech which usually stand next to nouns and modify them.

They give us information about that noun by answering questions: what kind, how many, which one.

What kind: He sat on a wet chair.

How many: I ate several cookies. (numbers also can function as adjectives)

Which one: The biggest has house in the street is mine.

In what way: She spoke to me quietly. - we see that adverbs answer to this question.

Read the following paragraph and then answer the question that follows:

Video games can kill! That is what many who support legislation banning violent titles from underage players have stated. These supporters of video game reform cite studies that show increased statistics of violence among children who play games regularly at home. Opponents of this reform, however, have expressed doubts about the validity of the studies, requesting that further research be done before a dramatic statement is made about all gamers. It seems that the rising popularity of video games among youth has spiked a political debate that may last for several more years to come.

Which sentence from this paragraph is the topic sentence? (5 points)

It seems that the rising popularity of video games among youth has spiked a political debate that may last for several more years to come.
That is what many who support legislation banning violent titles from underage players have stated.
Video games can kill!
Opponents of this reform, however, have expressed doubts about the validity of the studies, requesting that further research be done before a dramatic statement is made about all gamers.

Answers

Answer:

no, video games don't kill they just damage ur brain and also ur focus......many people don't see that video games just make ur time wasted than doing important things

please help i’ll give brainlist

Answers

Answer:

A

Explanation:

Your headmaster must be sack from the school, write your speech for the motion

Answers

Answer:

?

Explanation:

Helpppppp
at what age do you learn how to take initiative

At what age do you learn what I’m good at ??

Answers

Explanation:

both answers are

any age

what are your thoughts on Moliere's tartuffe?

Answers

Madame Pernelle, visiting her son Orgon's house, uses the opportunity to criticize all the members of the house and to praise their boarder, Tartuffe, because he is a man of such holiness and zeal. The others present offer objections to Tartuffe, maintaining that he is false and hypocritical, but Madame Pernelle will not entertain such thoughts. As she leaves, she admonishes everyone to follow Tartuffe's precepts.

After Madame Pernelle's departure, Cléante and Dorine talk about Tartuffe and both agree that he has beguiled Orgon. Damis, Orgon's son, wonders whether his father will still allow Mariane to marry Valère; Damis must know Orgon's feelings because he wants to marry Valère's sister. He asks Cléante to question Orgon about his promise to allow the marriage to take place.

Correct the errors.I have a five years old daughter and a three years old son

Answers

Answer:

HERE

Explanation:

I have a five year old daughter, and a three year old son.

Answer:

I have a five year old daughter and a three year old son?



why is it inappropriate to label young children with
behavioral disorders? What would be more helpful?

Answers

Answer:

To label young children is absurd. As to every creature that walks the planet, adulthood comes at different times, along with mental maturing and stability. A more helpful way to treat this issue is giving the child more time to adapt to others ways instead of labeling as a disorder.

Explanation:

2 Choose the correct option.
1 I finished all my homework last night / now.
2 Peter didn't finish his homework yet / on time.
3 Sorry, we haven't sorted it out yet / yesterday.
4 I've watched all the movies he's made since 1984 /20 years
ago.
5 We've never had an accident before / this morning.
6 Alice worked in Russia recently / last year.
7 Dad hasn't felt well recently / on Thursday.
8 She didn't go out since the weekend / over the weekend.
9 Andrew hasn't been around for ages / a few days ago.
10 I've done a lot this week / last week.

Answers

Answer:

1) last night

2) on time

3) yet

4) since 984

5) before

6) either are correct

7) recently

8) over the weekend

9) for ages

10) this week

why is your coat on the chair?Can you .............................in the closet

a, pick up

b, take up

c, drop off

d, hang up

Answers

Hang up in the closet

The complete statement will be why is your coat on the chair? Can you hang up in the closet. The correct option is d.

What is a sentence?

A sentence is the fundamental unit of language that expresses an entire thought. It accomplishes this by adhering to the basic grammatical rules of syntax.

A simple sentence is one that contains only one clause, or an independent clause with a subject and a predicate.

A sentence is a complete grammatical idea. Every sentence has a noun or pronoun component known as the subject and a verb component known as the predicate.

Declarative sentences (which are statements), interrogative sentences (which are questions), and imperative sentences are the three basic types of sentences.

Why is your coat on the chair will be the full statement. Can you hang up your clothes in the closet?

Thus, the correct option is d.

For more details regarding sentence, visit:

https://brainly.com/question/18728726

#SPJ2

definition of mental​

Answers

Answer:

lose one's self-control, typically as a result of anger or excitement.  

become unable to control one's temper or emotions.

Explanation:

My friend Betsy blank late for rehearsal. I blank her to make sure she was not sick.

Choose the verbs that make these sentences correct.

a.
will be / call

b.
was / call

c.
was / called

d.
is / calling

Answers

Answer:

the answerto your question is c.

Help Please =/ =/ =/ =/

Answers

Answer: Boredom can enhance creative problem solving. While often people use technology to escape boredom they should take advantage of it

But a bird that stalks

down his narrow cage

can seldom see through

his bars of rage

his wings are clipped and

his feet are tied

so he opens his throat to sing.

—"Caged Bird,”
Maya Angelou

Read the second stanza of the poem. Then, answer the questions to make connections between the autobiography and the poem.

What is the only act of freedom the caged bird has?



What does Marguerite do when she begins to feel free?

Answers

Answer:

What is the only act of freedom the caged bird has?

C-singing

What does Marguerite do when she begins to feel free?

B-speaks

Explanation:

Answer:

What is the only act of freedom the caged bird has?

C-singing

What does Marguerite do when she begins to feel free?

B-speaks

Explanation:

ur welcome ;)

Which two characters are most alike according to their personality descriptions?

A. Friar and Yeoman
B. Miller and Franklin
C. Parson and Knight
D. Plowman and Summoner

Answers

B I hope this helps I might be wrong good luckk

For what is Harry Patch most well-known?

Answers

Answer:

the Last Fighting Tommy

Henry John Patch (17 June 1898 – 25 July 2009), dubbed in his later years "the Last Fighting Tommy", was an English supercentenarian, briefly the oldest man in Europe, and the last surviving combat soldier of the First World War from any country to have fought in the trenches.

If I gave you the word ‘successful’ does that word have a prefix or suffix? What would it be?

Answers

Answer:

Suffix and the suffix is LY

Explanation:

Which sentence from the first handwritten letter is in the present tense?

a.
As planned, our neighbor's son-in-law, a fine young man, met me at the boat dock.

b.
I have a roof over my head, and I am warm and dry.

c.
Many people were not allowed to go into New York City.

d.
I will send for you soon.

Answers

B.

Explanation: All of the other sentences listed are written in the past tense. "I have a roof over my head, and I am warm and dry." is written within the present tense.

WILL GIVE BRAINLIEST!!
Explain which region you would have liked to live in during the Second Industrial Revolution and why. (North, South, West, or Midwest.)

Answers

Answer:

During the Second Industrial Revolution I would want to live in the northern region. Advancements in manufacturing and production technology enabled the widespread adoption of technological systems such as telegraph and railroad networks, gas and water supply, and sewage systems, which had earlier been concentrated to a few select cities. This making me entitled to live in the northern part.

Explanation:

A fossil is
a.
an imprint in stone of something that once lived.
b.
an ancient way of writing, carved into stone or stamped into clay.
c.
something that human beings learned how to make and use.
d.
a written record.
V

Answers

Answer:

Its A

Explanation:

write a 1000 word journal entry . please hurry

Answers

Answer:

Honestly, this is a dramatic question.

Explanation:

You simply can write a journal with 1000 words. Like come on, who can't write a story with ten words!

Which word best describes Sabor? A cautious B loving C protective D angry​

Answers

Answer:

A. Cautious Hope this helped you brainiest please and have a great day!

Explanation:

Which word best describes Sabor?

A. Cautious

Answer:

protective or angry

Explanation:

sabor means flavor but your options don't match so instead I thought of it like sabertooth tiger which is protective and angry ish not really sure on that one

Which of the following best explains why Tessie is unhappy with the first drawing?
A. She was not on time.
B. She believes her husband was hurried.
US
OC. She knows Mr. Summers dislikes the Hutchinsons.
D. She was not allowed to draw.

Answers

Answer:

A

Explanation:

:/) (-/because she was not on time so she's unhappy cause yeah so uuhh yeahh that's it... You pretty sure

This itinerary leaves us plenty of lee-way to make up for the lost sleep.

Rewrite;replacing the phrasal verb lee-way with a word or phrase that means the same​

Answers

Answer:

This itinerary leaves us plenty of freedom to make up for the lost sleep.

Explanation:

not really sure how I would explain it.

Other Questions
When did the agency say something would be stolenBy evening In the afternoonIn the eveningAt 5:30pmThe answer is by evening Do you believe athletes need to be involved in social change? Why? Help me with this problem please please:):) Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies