anybody know the answer for this question ? thank you

Anybody Know The Answer For This Question ? Thank You

Answers

Answer 1

Answer:

i think its: have a nucleus, cytoplasm and cell membrane

Explanation:

srry if im wrong i only know if they have a nucleus or not in which they do


Related Questions

HELPPPP
We have half of our genetic material from our mom and half from our dad
agree/disagree

Answers

Answer:

Agree. We Get One Chromosome from each Parent

Explanation:

which health issue is associated with exposure to indoor air pollution

Answers

Answer:

irritation of the eyes,nose and throat;headaches,dizziness,fatigue;respiratory diseases,heart disease,and cancer.

Explanation:

(hope this helps)

Answer:dddddddddddddddddddddddddddddd

Explanation:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

The service box is an area on the court that 1 point the person serving must stand in. the ball must land in to be a playable serve. the person returning the serve must be standing in before a server can serve ​

Answers

Answer:

Both players on the serving doubles team have the opportunity to serve and score points until they commit a fault *(except for the first service sequence of each new game).

The first serve of each side-out is made from the right-hand court.

If a point is scored, the server switches sides and the server initiates the next serve from the left-hand court.

As subsequent points are scored, the server continues switching back and forth until a fault is committed and the first server loses the serve.

When the first server loses the serve the partner then serves from their correct side of the court (except for the first service sequence of the game*).

The second server continues serving until his team commits a fault and loses the serve to the opposing team.

Once the service goes to the opposition (at side out), the first serve is from the right-hand court and both players on that team have the opportunity to serve and score points until their team commits two faults.

In singles the server serves from the right-hand court when his or her score is even and from the left when the score is odd.

Explanation:

6. Parts per million is used to express the A) atomic mass of an element B) concentration of a solution C) volume of a substance D) rate of heat transfer A B​

Answers

B. Concentration of a solution

land where it is possible to grow crops is called
A.organic land
B.agricultural land
C.vegetative land
D.All of the above

Answers

D. All of the above

plz help giving brainliest!!!!!
What is the function of the outer covering in fish?
1 Protects the fish from their environment
2 Supports the body and internal organs
3 Used for reproduction
4 Works with the muscles to allow movement

Answers

Answer:

Your answer is A,

Explanation: D can be argued for as well but those are the secondary functions of scales. Their main function is to protect the fish.

Many fish contain an outer covering of scales. Scales protect fish, much like a suit of armor. All fish have a dirty covering of mucus. This substance permits the fish to swim through the water with very little yawn and also makes it hard for other organism to adhere to the fish.

What are the functions of the parts of a fish?

The dorsal and ventral fins mainly help fish to not move over onto their flanks.

The caudal fin is the main fin for propulsion to move the fish forward. The coupled fins help with steering, stopping and hovering.

Thus option "A" is correct,  Protects the fish from their environment.

To learn more about fish click here:

https://brainly.com/question/20594595

#SPJ2

The diagram illustrates the foraging distribution of three different species of waterfowl in a pond and surrounding wetland areas.
Which statement accurately explains the phenomenon shown in the illustration?

Answers

Answer: C) Each species evolved a unique foraging area as a natural result of competition.

Explanation: i just took the test

What is the main adaptive advantage of the C4 and CAM photosynthesis strategies over C3 photosynthesis?
a.They make it possible for the plant to use the Calvin cycle during the day.
b.They allow the plant to synthesize glucose without CO2.
c.They allow the plant to hold its breath and still perform photosynthesis.
d.They allow the plant to synthesize glucose under hot conditions.

Answers

Answer:

D. They allow the plant to synthesize glucose under hot conditions.

Explanation:

C4 and CAM photosynthesis strategies allow for plants to produce glucose in hot and dry conditions.

Plants such as cacti, which live in hot conditions, have the advantage from their C4 and CAM systems.

In contrast to C3 photosynthesis, C4 and CAM systems allow plants to get more CO2 from the air and help them conserve water.

This then allows them to efficiently create glucose with the CO2.

So, the correct answer is D.

Answer:

D. they allow the plant to synthesize glucose under hot conditions.

Explanation:


Outline the effect of the following mutations:
TAG-> TAT
TAC-> TCC

Answers

Answer:

TAG-> TAT >> sense mutation  

TAC-> TCC >> missense mutation

Explanation:

A sense mutation is a type of mutation that changes a stop codon into a sense codon, thus producing an elongated protein. The TAG codon (UAG in the RNA) is a stop codon, while TAT (UAU) encodes for tyrosine, thereby TAG-> TAT is a sense mutation. On the other hand, a missense mutation is a type of point mutation where a single nucleotide change generates a new codon which encodes a different amino acid. In this case, the TAC codon (UAC) encodes for tyrosine, while TCC (UCC) codon encodes for serine, and therefore TAC-> TCC is a missense mutation (Tyr to Ser mutation).

Pyramids depicting the number of organisms or biomass may be inverted, upright, or even diamond-shaped.
Energy pyramids, however, are always upright. Why?

Answers

Answer:

The correct answer is - as energy lost at every trophic level.

Explanation:

In any ecological ecosystem the energy pyramids always upright unlike other pyramids such as biomass showing the number of organisms, that can be diamond shape, inverted or upright.

The main reason behind this is due to the fact that it is only a pyramid in the ecosystem that always unidirectional in the food chain which is always some energy lost with an increase in the trophic level in the food chain. This loss of energy always gets back to the atmosphere in each step of the food chain.

As the energy is lost at every trophic level, the energy pyramids are always upright. A further explanation is below.

In whatsoever biological environment, the energy pyramid always seems to be straight, unlike some of the other pyramidal, including such biomass, which might be diamond-shaped, overturned, as well as upstanding.Essentially the food chain is simply a pyramid, and there is always some power loss as that of the primary consumers throughout the chain increases.

Thus the response above is right.

Learn more:

https://brainly.com/question/13010665

Based on your observations, what do warm fronts seem to have in common?

Answers

Answer:

Warm fronts are characterized by low cloud cover and higher temperatures.

50 POINTS 4. The age of the Canyon Diablo meteorite was determined by
A) carbon-14
B) uranium-235
C) hydrogen-3
D) potassium-40​

Answers

Answer:

The answer is uranium have an awesome day!

In a microclimate, the conditions of the small area are______?
A. the same as in the larger surrounding area
B. microclimates do not exist
C. much different than in the larger surrounding area
D. always hotter than in the larger surrounding area

Answers

the answer should be option A

The coordinates of the vertices of a polygon are shown below.

M(–1, 3), N(–4, 0), O(–1, –3), P(3, –3), Q(4, 0), R(3, 3)

What type of polygon is this figure?

Answers

Answer:

a hexagon

Explanation:

since it has six sides

which of these is an example of an abiotic factor
A:creosote plant
B:rocky desert soil
C:kangaroo rat
D:coyote

Answers

Answer:

[tex]\boxed {\boxed {\sf B. \ Rocky \ desert \ soil}}[/tex]

Explanation:

An abiotic factor is a part of an ecosytem, but it is not alive. Some examples include water, rocks, sunlight, and the atmosphere.

On the other hand, a biotic factor is a living part of an ecosystem. Some examples are animals, plants, and fungi.

Let's look at the answer choices.

A creosote plant (choice A) kangaroo rat (choice C) and coyote (choice D) are all living organisms. Therefore, they must be biotic factors.

However, rocky desert soil (choice B) is not living. It's a part of the ecosystem, but since it's not alive it must be abiotic.

The limiting nutrient to plants is often

A. usable nitrogen
B. protein
C. liquid water

Answers

A

hope this helps :)

Scientific ideas are open to being revised. Which of the following would most likely lead to a scientific idea being revised?

1. A scientist makes observations to test an older idea.
2. A scientist raises new questions about an older idea.
3. A scientist has a new idea that goes against an older idea.
4. A scientist collects data that fails to support an older idea.

Answers

Answer: Number 2

Explanation: As researchers explore the world through new scientific studies and observations, new evidence may challenge existing and well-known theories. The scientific process allows for the consideration of new evidence that, if credible, may result in revisions or changes to current understanding.

Hurry!!! Timed!! Do NOT answer with a link!!!
Which statements describe gene therapy? Check all that apply.
A. It cures all cases of cystic fibrosis.
B. It involves the modification of DNA. C. It is easy to apply to all cells affected by the disorder.
D. It attempts to replace a mutated gene with normal DNA. It does not always cure patients who use it.​

Answers

B. and D. I think would be the answers hope this helps

Answer: B, D

Explanation:) edge 2022

All of the following have been accomplished by space programs except-

A. placing semi-permanent structures in earth’s orbit

B. landing spacecraft on planets other than our own

C. sending spacecraft into orbit that allow us to study the universe in greater detail

D. develop technology and resources capable of sending the general population into space on a regular basis

Answers

Answer:

B

landing spacecraft on planets other than our own

What percentage of the possible offspring will be hybrids?

Answers

Answer:

50 %

Explanation:

A dry cement road is a diffuse reflector. When it rains, the water fills in all the little holes and cracks in the cement road and it becomes a smooth regular reflector. At night, when you are depending on the light from your headlights to show you the lines on the road, a wet road becomes much darker and it is more difficult to see the lines. Explain why this occurs.

Answers

Answer:

Because of reflection of light away from the marking

Explanation:

It is because the light from a vehicle falls on the road and its markings which then gets illuminated as light is reflected only in one direction.

But in case when the road is wet, light of vehicle reflects in different directions away from the markings on the road and hence they do not illuminate.

The reason why the given phenomenon about the effect of light and while driving is; Due to total internal reflection of light away from the marking.

What is reflection of light?

Reflection of light is simply defined as the phenomenon where light is sent back after being incident on a surface.

Now, in this question, the light from a vehicle falls on the road and its markings and then gets illuminated as light is reflected only in one direction.

However, when the road is wet, the headlight of vehicles tend to reflect away from the markings on the road in different directions which make them not to illuminate.

Thus, we conclude that reason why the given phenomenon about the effect of light and water on driving is due to total internal reflection of light away from the marking.

Read more about reflection of light at; https://brainly.com/question/437098

Which phase comes NEXT?

Answers

Answer:

telophase is the correct answer

Explanation:

sorry if its incorrect.

13-22 Aquaculturists (people who farm marine resources, typically in semi-enclosed areas off the coast) have development methods of growing various invertebrates as food sources, such as clams, mussels, and oysters. Other widely consumed species, such as squid, have never been successfully grown in controlled marine environments, and so they remain wild caught. Why

Answers

Answer: There are several problems associated with handling of the squid.

Explanation:

Squid is a deep sea creature which becomes enormously big in size and difficult in handling in artificial water body or aquaculture.

It consumes and requires huge amount of food in the pre-larval stages typically phytoplankton and it becomes difficult to provide such food to them.

The maintenance of temperature, and salinity for the squid in aquaculture is difficult.

The sticky arms of the squid adhere to the surface of tub or human handler making it difficult to handle and can be poisonous to humans too.

An example of chemical digestion is the breakdown of
into
Select one:
O a. fatty acids; cholesterol
O b. polysaccharides; amino acids
c. amino acids; proteins
d. proteins; nucleotides
nucleic acids; nucleotides
e.

Answers

Answer:

B

Explanation:

An example of chemical digestion is the breakdown of nucleic acids, or nucleotides, which is in option e. Chemical digestion involves the breakdown of large, complex molecules into smaller ones, so here the correct option is option e.

Chemical digestion is a process that occurs in the digestive system, specifically in the stomach and small intestine, where complex macromolecules are broken down into smaller, simpler units through chemical reactions facilitated by digestive enzymes. Proteins are large macromolecules made up of chains of amino acids. Hence, here the correct option is option e.

Learn more about chemical digestion here.

https://brainly.com/question/14977182

#SPJ4

4 Which factor determines whether an energy resource is renewable or nonrenewable
energy? 6.ESS3.1
A whether or not the resource can be sold to people for money
B. the types of energy conversions involved in forming the resource
C. the amount of pollution produced from obtaining and using the resource
D. the ratio of the rate at which it is used to the rate at which it is replenished

Answers

Answer:

D the ratio of the rate at which it is used ....

why groups of animals are found on some islands but not others?

Answers

Answer:

Wilson has created the theory of the biogeographic nature of the island, which predicts that the number of species on the island depends on the balance between colonization, the evolution of the novel island species, and extinction.

Explanation:

A new DNA sequence containing 596 species of terrestrial birds from 41 island chains (archipelagos) around the world has been assembled by the researchers. The data combined sample data from their own field visits, research, and field samples from GeneBank colleagues. This information was utilized to build and employ a dynamic model that predicted international relationships that regulate biodiversity variation in their novel analysis approaches. In that, they confirmed two main components of MacArthur and Wilson's initial biogeography theory on the island.

The understanding of biodiversity on the island is important to conservation but also has implications beyond that – when imposing barriers to species dispersal it could enable us to assess better the effects of human activities, and it can contribute to a wider understanding of biodiversity around the globe.

Give me your best shot of explaining how this occurred. This is different from the twins as this time both parents have darker skin, some of the offspring share that same skin color and some are albino

Answers

The parents might be heterozygous for albinism. So Aa and Aa for example. So their children have a 25% chance of having albinism

The process by which natural variation among organisms that make them best adapted to their environment live and reproduce, therefore passing on to their offspring the genetic qualities best suited to that environment
variation
variation

adaptation
adaptation

natural selection
natural selection

Evolution

Answers

Answer:

Natural Selection

Which statement provides the best explanation of the difference in biomass of organisms found at each trophic level?

Answers

Answer: organisms at higher tropic levels have less energy available to them in organisms at lower trophic levels

Explanation:

Given the present condition of the country and based on your own observation,would you consider the philippines an effective,weak, or failed state?why?​

Answers

Answer:

Weak.

Explanation:

The Philippines is a weak and financially poor country due to its current condition. The main reason for its weak state is due to the poor economy that is responsible for its weak state. The environment is not favourable for the investors and business due to costly facilities that prevent the investors to invest in the country. If the environment for the investor is good so the investors come to the country and contributes in the economy which make the financial situation of the country better.

Other Questions
b+2.01=5.5what does B stand for which statement best describes an example of selective breeding? I lift a 20kg ball up 2.5 meters off the ground on Earth.-Earths gravitational acceleration is about 9.8 m/s2.How much gravitational potential energy does the ball have at this point? _____________How much work did I do lifting up the ball? _____________________________________If I lift the same ball the same distance on the Moon, then how much gravitational potential energy will it have? (Moons Gravity = 1.6 m/s2) ____________________________________ Which signposts uses words that have a strong connotation?-Contrast and contradictions-Extreme or absolute language -Numbers and stats Based on the maps, what region did more railroads tracks develop - the North or South? Why do you think so? Of the 180 students in Mrs. Stanfield's class,60% are girls On Thursday, 25% of the girls in theclasses dressed up for Wacky Tacky Day. How manygirls dressed up? Should English be capitalized in this sentence?Today I went to English class. A battery causes a current of 2.0 A to flow through a lamp. The power used by the lamp is 12 watts. What is the voltage? Which of the following is an example of intrinsic motivation?A.composing a piano tude for extra credit in your music appreciation course B.writing a song to perform at your parents' 25th anniversary party C.creating a mixed-media collage in hopes of winning a blue ribbon at a local art fair D.building a robot to enter in a competition that offers a $500 first prize Which option describes a research question? (1 point)O a question that identifies a topic that you want to learn more aboutO a question that reveals where you can find information about a topicO a question placed in the conclusion of an essay to me the reader thinka question that encourages the reader to find out more about the topicNo Which of the following characteristics of the planet, Earth, is essential tothe survival of every living organism?*Earth has abundant available water.O Earth has just one orbiting moon.O Earth orbits the Sun once every 365 days.O Earth rotates on its axis once every 24 hours. Two toy robots are turned on at the same time. The first robot beeps every 24 seconds. The second robot beeps every 36 seconds. In how many seconds will they beep at the same time? Choose only ONE best answer. 12 B 24 36 72 E 96 PLEASE HELP I ONLY HAVE AN HOUR LEFT !!!!!! please help me with this chem question!! Which phrases tell causes of suffering for blacks in northern cities after World War II? Choose all answers that are correct. Look at the net of square pyramid below l. What is the surface area? Solve by grouping 8x^3+3+6x^2+4x A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include "The blue whale is the world's largest animal. What other amazing feature isit known for?*A) Its the quietest animalB) Its the loudest animalC) Its the heaviest animalD) Its the lightest animalChoose one of them. to be useful for most household applications, DC voltage is?please