any compound that increases the number of hydronium ions when dissolved in water, is called ?

Answers

Answer 1

A compound that increases the number of hydronium ions (H₃O⁺) when dissolved in water is called an acid. Acids are characterized by their ability to donate protons (H⁺) to water molecules, resulting in the formation of hydronium ions. This process is known as acid dissociation.

The strength of an acid is determined by its ability to donate protons. Strong acids, such as hydrochloric acid (HCl) or sulfuric acid (H₂SO₄), completely dissociate in water, resulting in a high concentration of hydronium ions. Weak acids, such as acetic acid (CH₃COOH), only partially dissociate in water, resulting in a lower concentration of hydronium ions.

Acids can have a wide range of applications in industry and everyday life, from the production of fertilizers and cleaning products to the preservation of food and the regulation of pH in the human body.

To learn more about hydronium ions refer to:

brainly.com/question/14619642

#SPJ4


Related Questions

Who can answer these for me?

Answers

Answer:

1. chlorine

2. hydrogen sulfide

3. phosphorus pentoxide

4. Oxygen difluoride

5. Phosphorus trichloride

6.Phosphorus pentoxide

7.Carbon disulfide

8.Nitrogen dioxide

9. Carbon monoxide

Why is it important to keep the NaOH solution stoppered at all times when it is not in use? oro To stop the Na OH solution occur the heat reaction with H2CO3, so the Naot solution can keen the best quality when we use it.

Answers

It is important to keep NaOH solution stoppered at all times when it is not in use because NaOH is a strong base that readily reacts with carbon dioxide (CO2) in air to form sodium carbonate (Na2CO3).

This reaction is exothermic, meaning that it releases heat, and it can also cause the solution to lose its concentration over time. By keeping the NaOH solution stoppered, exposure to air and carbon dioxide is minimized, which helps to maintain the purity and concentration of solution. In addition, the presence of sodium carbonate can interfere with many chemical reactions, so it is important to minimize its formation in the NaOH solution. Therefore, proper storage of NaOH solution is essential to maintain its quality.

To know more about sodium carbonate, here

brainly.com/question/13565765

#SPJ4

which of the following is true of a thermochemical equation? it includes only the change in enthalpy value. it includes the unbalanced chemical reaction and the change in enthalpy value. it includes the balanced chemical reaction and the change in enthalpy value. it includes only the balanced chemical reaction.

Answers

The correct option among the following is (c) it includes the balanced chemical reaction and the change in enthalpy value is true of a thermochemical equation.

A thermochemical equation is a chemical equation that depicts the complete thermochemical reaction. It contains the balanced equation and a written interpretation of the net energy change.

The term "enthalpy of reaction" refers to the heat energy released or absorbed in a chemical reaction at a constant pressure.

Thermochemical equations are written in the same way as chemical equations, with the exception that they also include the change in enthalpy value (ΔH) for the reaction.

The change in enthalpy value reflects the energy absorbed or released by the reaction in the form of heat.

To know more about enthalpy, refer here:

https://brainly.com/question/13996238#

#SPJ11

if 5.0 moles of sulfur dioxide react with 64 grams of oxygen and excess water, how many moles of sulfuric acid are produced

Answers

So the number of moles of H₂SO₄ produced is also 5.0 moles. Therefore, the answer is 5.0 moles of sulfuric acid.

To find the number of moles of sulfuric acid produced, we must first identify the chemical equation for the reaction between sulfur dioxide and oxygen to produce sulfuric acid.A balanced chemical equation for the reaction between sulfur dioxide and oxygen to produce sulfuric acid is as follows:

2SO₂(g) + O₂(g) + 2H₂O(l) → 2H₂SO₄(l)

From the equation above, we can see that the mole ratio of SO₂ to H₂SO₄ is 2:2 or 1:1, which means that for every mole of SO₂ that reacts, we produce one mole of H₂SO₄.

We are given that 5.0 moles of SO₂2 react, so the number of moles of H₂SO₄ produced is also 5.0 moles. Therefore, the answer is 5.0 moles of sulfuric acid.

Learn more about moles on:

https://brainly.com/question/29367909

#SPJ11

What percent of zinc in a 25.5 g sample of Zn³(PO4)?​

Answers

Explanation:

From periodic table:  

Zn = 65.38    gm/mole         X 3 =196.14  

P= 30.974

O = 15.999                           X 4 =63.996

Total mole wt = 291.11  gm     of which  196.14 is Zn

196.14 / 291.11 x 100% = 67% Zn

(NOTE that the sample mass of 25.5 g is irrelevant)

Determine the mass of one atom of gold,Au.(molar mass of Au:196.97)g

Answers

1 atom Au multiplied by 196.96655g/mol x 1mol/6.022 x 1023 atoms equals 3 x 10-22g Au  

An element's molar mass equals its atomic weight. In the instance of gold, Au, the molecular mass per mole is 196.967 grams.

Au molar mass = 196.96655 g/mol Convert ounces au to moles or moles to au gold to grams Composition percentage by ingredient Determine an organic compound's molecular weight.

As per the given details, the mass of one atom of gold (Au) is approximately 3.27 x [tex]10^_{-22[/tex] grams.

We may use the molar mass of gold and Avogadro's number to calculate the mass of one gold atom (Au). The particle density of Avogadro's number, abbreviated "NA," is roughly 6.022 x [tex]10^{23[/tex] particles per mole.

It is given that,

Molar mass of gold (Au) = 196.97 g/mol

Mass of one atom of gold = (Molar mass of gold) / (Avogadro's number)

Mass of one atom of gold = (196.97 g/mol) / (6.022 x [tex]10^{23[/tex] particles/mol)

Mass of one atom of gold ≈ 3.27 x [tex]10^_{-22[/tex] grams

Thus, the molar mass is 3.27 x [tex]10^_{-22[/tex] grams.

For more details regarding molar mass, visit:

https://brainly.com/question/31545539

#SPJ6

a compound that converts a mixture of two enantiomers and diastereomers by reacting with them is called a

Answers

A compound that can convert a mixture of two enantiomers and diastereomers by reacting with them is called a resolving agent.

Resolving agents are typically chiral compounds that have the ability to selectively interact with one enantiomer or diastereomer in a mixture, leading to the formation of a product that can be separated from the remaining unreacted enantiomer or diastereomer.

Resolving agents can be used in a variety of applications, such as in the synthesis of chiral compounds, the separation of racemic mixtures into their individual enantiomers, and the determination of the absolute configuration of chiral compounds. Common examples of resolving agents include enzymes, chiral metal complexes, and chiral organic molecules such as tartaric acid and its derivatives.

Overall, the use of resolving agents is an important tool in the field of stereochemistry, allowing for the manipulation and separation of chiral compounds in a wide range of applications.

To learn more about enantiomers refer to:

brainly.com/question/21506956

#SPJ4

molarity how can the concentration of a solution be expressed quantitatively?

Answers

The concentration of a solution can be expressed quantitatively through the concept of molarity.

What is Molarity?

The number of moles of solute present in one liter of the solution is called molarity (M). It is a quantitative measure of the concentration of a solution. The following formula is used to calculate the molarity of a solution:

Molarity = Moles of solute/Liters of solution

In other words, molarity is a measure of how many moles of solute are dissolved in one liter of the solution. It is generally expressed in moles per liter (mol/L). For example, a 0.1 M solution of sodium chloride means that there are 0.1 moles of sodium chloride present in one liter of the solution.

Importance of Molarity

Molarity is an important concept in chemistry as it is used to determine the amount of a chemical substance in a solution. It is widely used in chemical reactions, stoichiometry, and in the calculation of pH, equilibrium constants, and other important chemical properties. It is also a useful measure in analytical chemistry and in the preparation of reagents for scientific experiments. Molarity plays a significant role in many areas of chemistry, including biochemistry, medicinal chemistry, and environmental chemistry.

Learn more about Molarity: https://brainly.com/question/23051191

#SPJ11

Draw a graph of number of electrons in the halogen molecule against the boiling point of the halogen

Answers

A halogen molecule's molecular weight, which is defined by the number of electrons and other atomic characteristics, is closely connected to the boiling point of the molecule. The boiling point of a molecule rises with molecular mass.

What is the halogens' pattern of melting and boiling points?

Going down group 7, the halogens' melting and boiling points rise. This is due to the bigger molecules as you move down to group 7. Stronger intermolecular forces develop.

What is the pattern of halogens' boiling points?

Fluorine's boiling point of -188°C, Chlorine's of -34.6°C, Bromine's of 58.8°C, and iodine's of 184°C, as well as the trend in melting temperatures, are explained by the strengthening intermolecular interactions that bind the halogen molecules together.

To know more about molecular weight visit:-

https://brainly.com/question/27988184

#SPJ1

nh3 is a weak base ( b=1.8×10−5 ) and so the salt nh4cl acts as a weak acid. what is the ph of a solution that is 0.079 m in nh4cl at 25 °c?

Answers

The pH of the 0.079 M NH4Cl solution at 25°C is approximately 5.54.

To find the pH of a 0.079 M NH4Cl solution at 25°C, we will first find the H3O+ concentration using the weak acid dissociation constant (Ka) for NH4+.

1. Write the dissociation equation for NH4+:

NH4+ (aq) ↔ NH3 (aq) + H3O+ (aq)

2. Determine the Ka for NH4+ using the relationship between Kb (1.8 × 10⁻⁵) and Kw (1.0 × 10⁻¹⁴):

Ka = Kw / Kb = (1.0 × 10⁻¹⁴) / (1.8 × 10⁻⁵) ≈ 5.56 × 10⁻¹⁰

3. Set up an ICE table to find the equilibrium concentrations of the species:

  NH4+    NH3   H3O+
I: 0.079    0     0
C: -x       +x    +x
E: 0.079-x  x     x

4. Write the Ka expression and substitute equilibrium concentrations:

Ka = (x × x) / (0.079 - x)

5. Since Ka is very small (5.56 × 10⁻¹⁰), we can assume that x is much smaller than 0.079, so we can simplify the expression:

Ka ≈ (x × x) / 0.079

6. Solve for x, which represents the H3O+ concentration:

x = √(Ka × 0.079) = √(5.56 × 10⁻¹⁰ × 0.079) ≈ 2.90 × 10⁻⁶

7. Calculate the pH using the formula pH = -log[H3O+]:

pH = -log(2.90 × 10⁻⁶) ≈ 5.54

You can learn more about pH at: brainly.com/question/3050355

#SPJ11

in xps the energy of the photoelectron is dependent on the binding energy of the sample. is this also true for an auger electron? explain why or why not.

Answers

In X-ray photoelectron spectroscopy (XPS), the energy of the emitted photoelectron is dependent on the binding energy of the sample. However, this is not necessarily true for an Auger electron.

In Auger electron spectroscopy (AES), an atom is ionized by an incident X-ray photon, and the resulting core hole is filled by an outer-shell electron. This process releases energy, which can be detected as an Auger electron. The energy of the Auger electron is dependent on the energy released in the filling of the core hole, rather than the binding energy of the sample.

The energy released in the filling of the core hole depends on the specific electronic configuration of the atom, rather than the binding energy of the sample. Therefore, the energy of an Auger electron is not necessarily dependent on the binding energy of the sample, but rather on the specific electronic transitions that occur during the Auger process.

To learn more about electrons refer to:

brainly.com/question/28977387

#SPJ4

what is the expected chemical shift of an alphatic ketone?

Answers

The expected chemical shift of an aliphatic ketone in a proton NMR spectrum is around δ 2.0-2.3 ppm.

The chemical shift is the location on the ppm scale that indicates the magnetic environment of a proton in a molecule. It is dependent on several factors, such as electron density, hybridization state, and neighboring atoms. In aliphatic ketones, the carbonyl group (C=O) usually appears in the region of δ 2.0-2.3 ppm.

This chemical shift results from the deshielding effect of the carbonyl group, which withdraws electron density from the carbon and its attached protons. The deshielding effect dominates over any shielding effect from the alkyl groups attached to the carbonyl carbon. As a result, the carbonyl proton has a higher chemical shift compared to other protons in the molecule.

Other protons in the molecule may have different chemical shifts, depending on their environment. The actual chemical shift value of the carbonyl proton may vary slightly, depending on the specific compound's structure and the experimental conditions.

To know more about NMR spectrum, refer here:

https://brainly.com/question/30465030#

#SPJ11

Which of the following will be more soluble in an acidic solution than in pure water?a. BaSO3b. Zn(OH)2c. CsCIO4d. PbSe. AgCI

Answers

The following will be more soluble in an acidic solution than in pure water is e. AgCl.

AgCl (silver chloride) would be more soluble in an acidic solution than in pure water. The solubility of AgCl in water is 0.00013 g/100 mL of water at 25 degrees Celsius, according to the solubility rules. Silver chloride solubility is influenced by the ion concentration in the solution, with higher ion concentrations resulting in greater solubility.

The solubility product constant, Ksp, of AgCl is very low, indicating that it is a sparingly soluble compound. When silver chloride is exposed to light, it decomposes into metallic silver and chlorine. The equation for the reaction is as follows:2 AgCl → 2 Ag + Cl2The other options that were given are not applicable to the given statement.

Learn more about solubility at:

https://brainly.com/question/14366471

#SPJ11

Y’all, I need help on this help me

Answers

ask

ask the question bro, i will be ready to assist.

maths/ch3m/physics/bio

potassium chlorate decomposes into potassium chloride and oxygen gas. (True or False)

Answers

Answer:

True

Explanation:

(with a manganese dioxide catalyst)

how many moles of fe will be formed from 4.1 moles of co? enter only the numeric value for your answer (no units).

Answers

The equivalent of 2.05 moles of Fe can be created from 4.1 moles of CO.

The balanced chemical equation for the reaction between CO (carbon monoxide) and Fe₂O₃ (iron(III) oxide) is:

3CO + Fe₂O₃ → 2Fe + 3CO₂

From the equation, we can see that 3 moles of CO reacts with 1 mole of Fe₂O₃ to produce 2 moles of Fe. Therefore, we can set up a proportion:

3 moles of CO / 1 mole of Fe₂O₃ = 2 moles of Fe / 1 mole of Fe₂O₃

Simplifying the proportion, we get:

3 moles of CO = 2 moles of Fe

Now, we can use this proportion to calculate the number of moles of Fe that can be formed from 4.1 moles of CO:

2 moles of Fe = (3 moles of CO / 1 mole of Fe₂O₃) x 4.1 moles of CO

2 moles of Fe = 12.3 moles of CO / mole of Fe₂O₃

Therefore, the number of moles of Fe that can be formed from 4.1 moles of CO is: 2.05 moles of Fe

To learn more about moles refer to:

brainly.com/question/26416088

#SPJ4

D. In many methods that employ multiple measurements, one particular type of measurement may be the "weak link" that limits overall precision. For the density measurements you made here, you will determine what contributes most to the CV of your calculated density - the measurements of mass or of dimensions. Typical standard deviation for length and mass using the equipment employed in this lab are the following:


Dimensions: 0. 01 cm

Mass: 0. 002 g

Select the data for your lightest object, focusing on its mass and its shortest dimension, and answer the following two questions:


(2pts)

What is the CV for the mass value?

(2pts)

What is the CV for the measurement of its shortest dimension?

(2pts)

e. Which type of measurements (mass or dimensions) had the greatest impact on the CV of the measured density? Choose the explanation


Mass measurements have the greater impact because the mass CV with lightest object was greater than its dimension CV.

Mass measurements have the greater impact because the mass CV with lightest object was lesser than its dimension CV.

Dimension measurements have the greater impact because the dimension CV with lightest object was greater than its mass CV.

Dimension measurements have the greater impact because the dimension CV with lightest object was lesser than its mass CV

Answers

We can draw the conclusion that compared to dimension measurements, mass readings had a smaller effect on the CV of the measured density.

To determine the contribution of mass and dimensions on the coefficient of variation (CV) of the calculated density, we can calculate the CV for both mass and dimension measurements separately for the lightest object.

Let's assume that the mass of the lightest object is 0.5 g and its shortest dimension is 1.0 cm. The CV for mass can be calculated as follows:

CV for mass = (standard deviation of mass / mean mass) x 100%

CV for mass = (0.002 g / 0.5 g) x 100%

CV for mass = 0.4%

Similarly, the CV for dimension can be calculated as follows:

CV for dimension = (standard deviation of dimension / mean dimension) x 100%

CV for dimension = (0.01 cm / 1.0 cm) x 100%

CV for dimension = 1.0%

From these calculations, we can see that the CV for mass is lower than the CV for dimension, indicating that mass measurements are more precise than dimension measurements for this particular object.

Therefore, we can conclude that mass measurements had a lesser impact on the CV of the measured density compared to dimension measurements. This is because the contribution of mass measurement uncertainty to the overall CV is lower than that of the dimension measurement uncertainty.

To learn more about CV for mass  refer to:

brainly.com/question/13304516

#SPJ4

what two gases are the primary causes of acid deposition

Answers

The two gases that are the essential drivers of acid deposition are sulfur dioxide (SO2) and nitrogen oxides (NOx).

These gases collaborate in the atmosphere to frame fine sulfate and nitrate particles that can be transported significant distances by winds and breathed profoundly into individuals' lungs.

Some sources of sulfur dioxide incorporate the consumption of fossil fuels such as coal, oil, and natural gas, petrol refineries, concrete assembling, paper mash production, metal smelting and processing facilities, and volcanic eruptions.

Sulfur dioxide can irritate the nose, throat, and airways causing hacking, wheezing, shortness of breath, or a tight searching of the chest. High concentrations of SO2 can cause inflammation and irritation of the respiratory system. Individuals with lung diseases such as asthma, constant bronchitis, and emphysema are for the most part more sensitive to sulfur dioxide. Youngsters are at higher risk from SO2 exposure because their lungs are still creating. Exposure to sulfur dioxide might irritate the eyes, nose, and throat.

to know more about Sulfur dioxide click here:

https://brainly.com/question/15654465

#SPJ4

Convert the following from moles to number of particles!!SHOW ur WORK

32.45 mol Cr3(PO4)2 = ____ formula units Cr3(PO4)2

Answers

6.53 1026 formula units of  [tex]\rm Cr_3(PO_4)_2[/tex] are contained in roughly 32.45 moles of  [tex]\rm Cr_3(PO_4)_2[/tex].

How to determine atoms?

We may use the following procedures to determine how many atoms make up the 32.45 moles of [tex]\rm Cr_3(PO_4)_2[/tex]:

Using Avogadro's number, which is the number of particles (atoms, molecules, or ions) per mole of a substance, we may convert from moles to the number of particles. There are roughly [tex]6.022 \times 10^{23[/tex] particles per mole according to Avogadro's number.

Hence, we can perform the following computation to convert 32.45 moles of  [tex]\rm Cr_3(PO_4)_2[/tex] to the quantity of  [tex]\rm Cr_3(PO_4)_2[/tex]'s formula units (ions):

32.45 mol [tex]\rm Cr_3(PO_4)_2\times 6.022 \times 10^{23[/tex] formula units/mol = [tex]1.955 \times 10^{25[/tex] formula units [tex]\rm Cr_3(PO_4)_2[/tex]

to know more about moles here:

brainly.com/question/26416088

#SPJ1

If the specific heat of the solid is 1.56J/gC, the specific heat for the liquid is 3.11 J/gC, the specific heat of the gas is .988 J/gC, the heat of fusion is 107 J/g, and the heat of vaporization is 854 J/g, Calculate all the energy absorbed by the sample as described above.

Answers

The total energy absorbed by the sample is 34276m + 30075.2 J.

What is the heat of fusion?

The heat of fusion is the amount of heat required to melt one unit of mass of a substance at its melting point without a change in temperature.

What is the heat of vaporization?

The heat of vaporization is the amount of heat required to vaporize one unit of mass of a substance at its boiling point without a change in temperature.

To calculate the energy absorbed by the sample, we need to know the mass of the sample and the temperature changes it undergoes. Assuming the sample starts as a solid at a temperature of -20°C, is heated to its melting point, melted, then heated to its boiling point, and finally vaporized, the calculations are as follows:

Energy absorbed to heat the sample from -20°C to 0°C:

Q = m * C * ΔT

Q = m * 1.56 J/g°C * (0°C - (-20°C))

Q = 31.2 * m J

Energy absorbed to melt the sample at 0°C:

Q = m * Hfus

Q = 107 J/g * 31.2 g

Q = 3338.4 J

Energy absorbed to heat the sample from 0°C to 100°C:

Q = m * C * ΔT

Q = m * 3.11 J/g°C * (100°C - 0°C)

Q = 311 * m J

Energy absorbed to vaporize the sample at 100°C:

Q = m * Hvap

Q = 854 J/g * 31.2 g

Q = 26636.8 J

Energy absorbed to heat the sample from 100°C to 200°C:

Q = m * C * ΔT

Q = m * 0.988 J/g°C * (200°C - 100°C)

Q = 98.8 * m J

Total energy absorbed:

Qtotal = 31.2m + 3338.4 + 311m + 26636.8 + 98.8m

Qtotal = 34276m + 30075.2 J

Learn more about heat of fusion here:

https://brainly.com/question/14053504

#SPJ1

Identify the phrases that generally apply to molecular compounds a. Contain metals and non-metals b. Are often gases or liquids C. Have low melting points d. Contain ionic bonds e. Use covalent bonding

Answers

Molecular compounds are compounds that generally contain non-metals and are often gases or liquids. These compounds usually have low melting points, which is due to their molecular nature. This type of compound is characterized by the use of covalent bonds to hold the atoms together.

Covalent bonds are formed when two atoms share the same electron, whereas ionic bonds are formed when one atom transfers electrons to another atom. This type of compound does not contain any metals, so the atoms form a molecular lattice structure instead of an ionic lattice structure.

The molecules created from covalent bonds are much more stable than those formed from ionic bonds, making them more likely to remain as gases or liquids. Molecular compounds are important components of many everyday materials, such as plastics and fabrics, and they play an important role in the chemical industry.

Know more about Molecular compounds here

https://brainly.com/question/20920787#
#SPJ11

How do you identify a Lewis acid and base in a reaction?

Answers

To identify a Lewis acid and base in a reaction, we might want to consider the steps below: :

Identify the reactants in the reaction.Determine the electron-pair donor and acceptor.Check for lone pairs of electrons. Consider the reaction mechanism.

What is a Lewis acid?

In any chemical reaction, a Lewis acid is described a specie that can accept a pair of electrons, while a Lewis base is a species that can donate a pair of electrons.

In conclusion, in order  to identify a Lewis acid and base in a reaction, we will need to identify the species that can accept or donate a pair of electrons and go ahead to determine which one is the electron-pair donor and acceptor.

Learn more about lewis acid at: https://brainly.com/question/22126064

#SPJ1

What are the names of the two common regenerated fibers?

Answers

The two common regenerated fibers are viscose rayon and lyocell. Both viscose rayon and lyocell have similar properties to natural fibers such as cotton and silk, but with the added benefit of being more affordable and easier to produce in large quantities.

Viscose rayon is a regenerated cellulose fiber made from wood pulp or cotton linters, and it has been used in the textile industry since the early 1900s. The manufacturing process involves dissolving the wood pulp or cotton linters in a chemical solution to form a viscous solution, which is then extruded through a spinneret and solidified into fibers.

Lyocell, also known as Tencel, is a newer type of regenerated cellulose fiber made from wood pulp, usually from eucalyptus trees. The manufacturing process for lyocell is more environmentally friendly than that of viscose rayon, as it uses a closed-loop process that recycles the solvent used in the production process. The resulting fibers are strong, durable, and moisture-absorbent, making them popular for use in clothing and textiles.

to know more about natural fibers, visit: brainly.com/question/9318560

#SPJ4

For the following question, choose TWO answers. Which question should be asked to determine if the reaction supports the Brønsted-Lowry model of acids and bases?
A
Did an acid donate a hydrogen ion to become a conjugate acid?
B
Did a base accept a hydrogen ion to become a conjugate base?
C
Did an acid donate a hydrogen ion to become a conjugate base?
D
Did a base accept a hydrogen ion to become a conjugate acid?
E
Did an acid donate a hydroxide ion to become a conjugate acid?
F
Did a base accept a hydroxide ion to become a conjugate base?

Answers

A and B Did an acid donate a hydrogen ion to become a conjugate acid? Did a base accept a hydrogen ion to become a conjugate base? should be asked to determine if the reaction supports the Brønsted-Lowry model of acids and bases.

In the Bronsted-Lowry hypothesis, proton transport between chemical species is used to characterize acid-base interactions. Any species that can transfer a proton, H, is a Bronsted-Lowry acid and a base is any species that can accept a proton. Based on whether a species receives or donates protons or H+, the Bronstad-Lowry acid-base theory (also known as the Bronsted Lowry theory) distinguishes between strong and weak acids and bases. The hypothesis states that when an acid and base interact, the acid forms its conjugate base and the base forms its conjugate acid by exchanging a proton.

Learn more about Brønsted-Lowry model here:

https://brainly.com/question/28145336

#SPJ4

When a diprotic acid is titrated with a strong base, and the Ka1 and Ka2 are significantly different, then the pH vs. volume plot of the titration will have
A. one equivalence point.
B. a pH of 7 at the equivalence point.
C. two distinct equivalence points
D. two equivalence points below 7.
E. no equivalence point

Answers

When a diprotic acid is titrated with a strong base, and the Ka1 and Ka2 are significantly different, then the pH vs. volume plot of the titration will have two distinct equivalence points. Thus, the correct answer is option C. For diprotic acids, the two acidic hydrogens (H+) are not lost at the same pH value.

The titration of a diprotic acid with a strong base yields two distinct pH curves as shown in the figure. The plot is also called a two-stage titration graph. The plot is divided into two stages because of the two dissociation steps of the diprotic acid. Titration curve for a diprotic acid. The curve has two equivalence points.

The first equivalence point corresponds to the reaction of the first hydrogen ion (H+) from the diprotic acid with the strong base. The pH at the first equivalence point is generally less than 7 because the salt of the weak acid is an acidic solution.

The second equivalence point occurs when all of the hydrogens have been neutralized. The pH at the second equivalence point is greater than 7 because the salt of the weak acid is a basic solution.

For more details about diprotic click here:

https://brainly.com/question/9434046#

#SPJ11

it is usually the case that heating a solution containing an enzyme markedly decreases the enzyme's activity. what might be the reason for this? the ability of a substrate to bind to its enzyme will decrease as temperature increases. increasing the temperature of a reaction will decrease the available free energy due to the increased entropy of the reaction. the elevated temperature will increase the activation energy of the catalyzed reaction. heating the solution will denature the enzyme.

Answers

Heating a solution containing an enzyme usually decreases the enzyme's activity. The reason for this might be: heating the solution will denature the enzyme. The correct option is D.

This may be due to the fact that: heating increases the enzyme's temperature, which may have a variety of effects on the reaction. Enzyme reactions are catalyzed by proteins, which are sensitive to temperature changes. Temperature can cause the enzyme to denature, which causes a structural change in the protein, resulting in a loss of function.

The enzyme's substrate ability to bind will decline as the temperature rises. As a result, raising the temperature of the reaction will reduce the amount of available free energy due to the increased entropy of the reaction. The elevated temperature may also raise the activation energy of the catalyzed reaction.

Enzyme activity is influenced by the temperature and pH of the environment in which they are located. It is important to keep the enzymes at the appropriate temperature and pH level to avoid denaturation and maintain enzyme activity. Enzyme function can be adversely affected by environmental factors such as temperature, pH, and salt concentration.

To know more about enzymes refer here:

https://brainly.com/question/13050632#

#SPJ11

Complete Question:

It is usually the case that heating a solution containing an enzyme markedly decreases the enzyme's activity. What might be the reason for this?

a. The ability of a substrate to bind to its enzyme will decrease as temperature increases.

b. Increasing the temperature of a reaction will decrease the available free energy due to the increased entropy of the reaction.

c. The elevated temperature will increase the activation energy of the catalyzed reaction.

d. Heating the solution will denature the enzyme.

Based on reference table F describe the solubility of silver iodide in water

Answers

Reference table F lists the solubility of various compounds in water at 25°C. According to the table, the solubility of silver iodide in water is 1.5 x 10⁻³ grams per 100 grams of water.

This means that at 25°C, 1.5 x 10⁻³ grams of silver iodide will dissolve in 100 grams of water.

Silver iodide is a sparingly soluble compound, which means that it has low solubility in water. This is due to the ionic nature of silver iodide, which results in strong attractive forces between the ions in the solid form.

As a result, only a small amount of silver iodide can dissolve in water, even at high temperatures. This low solubility has important implications for the use of silver iodide in various applications, including photography and cloud seeding.

To know more about silver iodide, visit:

https://brainly.com/question/30010042

#SPJ1

45. a 250.0-ml buffer solution is 0.250 m in acetic acid and 0.250 m in sodium acetate. what is the initial ph of this solution? what is the ph after addition of 0.0050 mol of hcl? what is the ph after addition of 0.0050 mol of naoh?

Answers

The initial pH of the buffer solution is 4.76, the pH after the addition of 0.0050 mol of HCl is 4.63, and the pH after the addition of 0.0050 mol of NaOH is 4.89.

What is buffer solution?

A buffer solution contains a weak acid and its corresponding salt, or a weak base and its corresponding salt. A buffer solution maintains a stable pH when an acid or a base is added to it. The following are the steps to solve the given problem.

The initial pH of a buffer solution can be calculated by the Henderson-Hasselbalch equation.

pH = pKa + log [A-]/[HA]pKa of acetic acid is 4.76A- = concentration of acetate ion = 0.250 mM HA = concentration of acetic acid = 0.250 mm pH = 4.76 + log [0.250]/[0.250]pH = 4.76

The addition of HCl will consume the acetate ions and increase the concentration of H+. The new buffer concentration will have a lesser concentration of acetate ion than the acetic acid, and the pH will decrease. Let x be the change in concentration of acetate ion, and 0.0050 - x be the new concentration of acetate ion.

The concentration of acetic acid is 0.250 M. After calculating x, the new pH can be calculated.

pH = pKa + log [A-]/[HA]x = 0.0050 mol/L of acetate ion consumed.

The concentration of the remaining acetate ion

= 0.250 - x0.250 - x = 0.2450 mol/L of acetate ion remaining [H+] = 0.0050 mol/L HCl added.

initial pH = 4.76

New pH = pKa + log [A-]/[HA] = 4.76 + log [0.2450]/[0.250] + log [0.0050]/[0.2450]

New pH = 4.63

The addition of NaOH will consume H+ ions and generate acetate ions. The new buffer concentration will have a greater concentration of acetate ion than the acetic acid, and the pH will increase.

Let y be the change in concentration of H+ ion, and 0.0050-y be the new concentration of H+ ion. The concentration of acetate ion is 0.250 M. After calculating y, the new pH can be calculated.

pH = pKa + log [A-]/[HA]y = 0.0050 mol/L of H+ ion consumed.

The concentration of the remaining H+ ion = 0.0050 - y0.250 + y = 0.2550 mol/L of acetate ion remaining[OH-] = 0.0050 mol/L NaOH added

initial pH = 4.76

New pH = pKa + log [A-]/[HA] = 4.76 + log [0.2550]/[0.250] - log [0.0050]/[0.2550]

New pH = 4.89

Therefore, the initial pH of the buffer solution is 4.76, the pH after the addition of 0.0050 mol of HCl is 4.63, and the pH after the addition of 0.0050 mol of NaOH is 4.89.

Learn more about pH on:

https://brainly.com/question/172153

#SPJ11

What is the percent composition of copper in copper (II) sulfate pentahydrate?

Answers

Answer: 63.92%

Explanation:

159.62 / 249.72 * 100 = 63.92. This means that a 100-gram sample of copper sulfate pentahydrate will contain 63.92 grams of copper sulfate. I hope this helps!

Consider the dissolution of NaBr and NaI. The values provided here will be helpful for answering the following questions. ΔH∘ soln (kJ/mol) ΔS∘ soln J/mol.K
NaBr –0.860 57.0
NaI –7.50 74.0
Write a balanced equilibrium equation for the dissolution of NaI in water. Include phases?
Which of the following explains why the entropy change is greater for the dissolution of NaI compared to the dissolution of NaBr?
Choose one: A. The interactions between bromide ions with other bromide ions is stronger than the interactions between iodide ions with other iodide ions. B. The cation forms stronger ion-dipole networks with water in NaBr than NaI because of the weaker bond to Br.
C. The more negative change in enthalpy observed with NaI implies greater dissociation and hence greater entropy.
D. Iodide has weaker ion-dipole interactions with water than bromide. E. The bromide ion has a more negative charge than the iodide ion. Therefore, because of the greater charge, it forms a stronger ion-dipole network with water. Calculate the change in free energy if 1.02 moles of NaI is dissolved in water at 25.0°C.
______ kJ What is the dissolution of 1.00 mol of NaBr at 298.15 K?

Answers

The balanced equation is NaI  → Na⁺ + I⁻, the entropy change is greater for the dissolution of NaI compared to the dissolution of NaBr is iodide has weaker ion-dipole interactions with water than bromide. Option D is correct, the change in free energy is  -16.4 kJ/mol, and  the dissolution of 1.00 mol of NaBr at 298.15 K is -4.07 kJ/mol.

The Balanced equilibrium equation for the dissolution of NaI in water:

NaI (s) → Na⁺ (aq) + I⁻ (aq)

Iodide having a weaker ion-dipole interactions with water than bromide. This is because the larger size of iodide ion causes weaker electrostatic interactions with water molecules compared to bromide ion. Thus, it requires more disorder or randomness to offset the loss of organization and ordering of water molecules. This results in a higher entropy change for the dissolution of NaI compared to NaBr.

ΔG° = ΔH° - TΔS°

ΔG° = (-7.50 kJ/mol) - (298.15 K)(74.0 J/mol.K)(1.02 mol)

ΔG° = -16.4 kJ/mol

The dissolution of 1.00 mol of NaBr at 298.15 K can be calculated using the following equation:

ΔG° = -RT ln(K)

where R is the gas constant, T is the temperature in Kelvin, and K is the equilibrium constant for the dissolution of NaBr in water.

Since NaBr is a strong electrolyte, it will dissociate completely in water:

NaBr (s) → Na⁺ (aq) + Br- (aq)

The equilibrium constant expression is:

K = [Na⁺][Br⁻]

At equilibrium, the concentration of Na⁺ and Br⁻ will be equal, so:

K = [Na⁺]²

The solubility of NaBr at 298.15 K is 90.7 g/L, which can be converted to mol/L:

90.7 g/L x (1 mol/102.89 g) = 0.881 mol/L

Therefore, [Na+] = [Br-] = 0.881 mol/L, and K = (0.881 mol/L)^2 = 0.775 mol/L.

Plugging in the values:

ΔG° = -8.314 J/mol.K x 298.15 K x ln(0.775 mol/L)

= -4.07 kJ/mol

To know more about entropy change here

https://brainly.com/question/4526346

#SPJ4

Other Questions
Why was the National Association of REALTORS Code of Ethics created? One pump can fill a swimming pool in 4 hours. A second pump can fillthe pool in 6 hours. If the pool starts empty, what part of the pool will befilled in each situation?The first pump works for 2 hours and the second pump works for 3hours.Pls help HELPhat is the approx. volume of the figure (Use 3.14 for pi) the additional expense of producing one more unit of a product is called:marginal costmarginal productprofit maximizing output TACAGGATCATTTCGCGAACGGAGCCGAACT1. Convert this DNA to Pre mRNA, mRNA, and tRNA Review of rsums is most valid when the content of the rsums is evaluated in terms of the elements of a job description. true/false What is transport in humans and plants and what is the difference? Which graph represents the solution to inequality which atomic particles are in a unique cloud outside of the nucleus of the atom? HELPPPPPPPPPPPP Plsss Solve 4^-2x 4^x = 641) Rewrite the equation using the same base. 2) Solve for x. Remember to show all work.PLEASE SHOW ALL WORK FOR BRAINLIEST PLEASEEE A buffer solution is prepared by adding NaH2PO4 to a solution of H3PO4. What happens if KOH is added? (1 point) one of the one-way functions used in public key cryptography is integer multiplication/factorization. multiplying two integers is easy, but factoring is hard. the number 3174277 is the product of two primes.what is the smaller of the two primes?what is the largest of the two primes? the second punic war a. saw the eventual victory of carthage over rome. b. saw hannibal invade italy from greece. c. won spain for rome and resulted in roman control over the western mediterranean. d. produced a great victory for the romans over hannibal at the battle of cannae. e. all of the above since conforming loans can be much more readily bought and sold in the secondary mortgage market, they carry a(n) interest rate than comparable nonconforming loans. a. higher b. equal c. more volatile d. lower PLEASE HELP WITH THESE TWO QUESTION 20 POINTSSSS Find the Value of X for 3, 4, 5, and 6, and tell whether or not these angles are adjacent or vertical. Remarkable identity fegley, incorporated, has an issue of preferred stock outstanding that pays a $5.60 dividend every year, in perpetuity. if this issue currently sells for $80.40 per share, what is the required return? cuvier's view that the extinction and the subsequent appearance of different creatires could be explained by a series of disasters and re-creations is called