Albert von Kölliker was the first researcher to isolate mitochondria, which are A) the structures in the center of cells that contain the DNA that governs all aspects of the cell's structure and function. B) the structures within cells that generate energy for fueling cellular processes. C) foreign proteins that cause the immune system to create an antibody. D) nutrient-rich materials that provide cells everything they need to grow.

Answers

Answer 1

Answer:

The correct answer is B

Explanation:

Mitochondria are membrane-bound cellular organelles that are found in eukaryotic plant and animal cells that produce high energy compounds (called ATP) that are responsible for cellular activities.

NOTE: ATP (adenosine triphosphate) is described as the unit for energy in biology, hence the answer is B

Answer 2

Answer:

B.

Explanation:

2021 Edge


Related Questions

Please put the following in order from Least Inclusive to MOST inclusive...

Organs Molecules Organ Systems
Organism Cells Tissue

A) Organism -> Organ Systems -> Organs -> Tissue -> Cells -> Molecules
B)Atoms -> Cells -> Molecules -> Organs-> Organ Systems -> Organism
C) Molecules -> Cells -> Tissue -> Organs -> Organ Systems -> Organism
D) Cells -> Organism-> Tissue -> Organ Systems -> Molecules -> Organs

Answers

Definitely C. A has it reversed, B includes atoms and puts molecules after cells, and D puts organisms right after cells

which statement best describes the forces in the picture?
a. The applied force in the force of friction are balanced.
b. all four forces are the same size.
c. all four forces are acting in the same direction.
d. The applied force in the force of friction are unbalanced.​

Answers

Answer: Its A.

Explanation:

None

The applied force and the force of friction are balanced in the picture because of which the person is standing still. Therefore option (A) is correct.

What is force?

A change in the force that is applied to an item with mass will cause that thing to move at a different speed. A body's state of rest or motion can be altered by the application of an external agent known as force. It is significant in both magnitude and direction.

The term "frictional force" refers to the force that is produced when two surfaces come into contact with one another and then slide against one another. A few factors that affect the force of friction are as follows: These forces are primarily influenced by the surface texture as well as the amount of force that is drawing them closer together.

Learn more about force, here:

https://brainly.com/question/13014979

#SPJ5

What is a carbon producer

Answers

Answer:

There are many many things in the world that produces Carbon. The largest source of greenhouse gas emissions from human activities in the United States is from burning fossil fuels for electricity, heat, and transportation. All of these produce Carbon into the atmosphere and warm the planet

PLEASE HELP ME I DONT KNOW THE ANSWER!!!!!

Answers

Answer: I think the answer is ( d) because the two tails are together to get stuck in the membrane as the picture shows

Explanation:

Which of the following is an example of a complex machine?
1. Pulley
2. Wedge
3. Scissors
4. Incline

Answers

3- Scissors are an example of a complex machine.

Answer:

A :3

Explanation:

Just did acceleratted ed. Hope this helps!

NEED ASAP


Which quality would make the question "What will make cows produce more milk?" a good scientific question for a
biologist to investigate?
A) It is about living things and is testable.
B) It will help consumers save money.
C) It will lead to new technology to gather milk.
D) It is a question that can have many answers.

Answers

Answer:

D

Explanation:

The scientist could find new tech, which could lead to lower prices, also, it is about living things and testable, so it would be many answers.

Which of the following correctly identifies the function of the cell membrane?
A
controls what enters and leaves the cell
B
produces protein and enzymes
C С
controls the cell function
D
stores genetic infromation for the cell

Answers

Answer:

a controls what enters and leaves the cell

Explanation:

please help me, 50 points

What type of bond are the arrows pointing to below in the picture


Answers

Thats is euther hydrogen bond or oxyegn bond. Im leaning towards hydrogen bond

Which of the following is caused by bad genes? *

Carcinoma
herpes
athlete's foot
vitaligo
bubonic plague

Answers

The answer is Vitaligo because all of the other answers are ones that you develop and not something you’re born with

What are the differences between the Big Bang Theory and the Steady State Theory?

Answers

Answer

One is a move and the other is a part of a state.

Explanation:

Answer:

The only difference, he explained, was that in the big bang scenario all the matter was created in one explosive beginning.

Explain the law's of segregation and independent assortment.

Answers

Answer:

The law of segregation states that the two alleles of a single trait will separate randomly, meaning that there is a 50% either allele will end up in either gamete. This has to do with 1 gene. The law of independent assortment states that the allele of one gene separates independently of an allele of another gene.

Explanation:

I know it late but can u plz mark me brainliest?

Which accurately labels the cytoplasm?
w
Х
Y
Z

Answers

Answer:

Y is the answer

Explanation:

I am 100%sure that the answer is Y

Choose one carbon sink and explain how the carbon gets out of it.

Answers

Answer::

Explanation:

what is human intercose

practical of human intercose​

Answers

Answer:

Sexual intercourse, also called coitus or copulation, reproductive act in which the male reproductive organ (in humans and other higher animals)

A cell membrane has permeability, which means that the membrane:

Answers

Answer:

transport proteins are specific and selective for the molecules they move, and they often use energy to catalyze passage.

Explanation:

I barley know what your trying to say

Dependence and Addiction are the
same thing?
a. True
b. False​

Answers

Answer:

b

Explanation:

one is a necessity, the other is a struggle

Write a one-paragraph essay that summarizes the relationship between chloroplasts and
chlorophyll, making sure to include how they work together in photosynthesis.

Answers

Answer:

New algorithms for estimating chlorophyll-a in the Spanish waters of the Western Mediterranean Sea from multiplatform imagery This manuscript proposes a set of multi-sensor chlorophyll-a empirical algorithms for improving current estimates of chlorophyll-a concentration in two distinct regions in the Mediterranean Sea.

Many studies in the area of cancer research are opening up new possibilities for cures and prevention measures.  One area of research is directed at the effects that chlorophyll may have on cancer cells within the human body.  Research is being conducted to investigate whether chlorophyll has important cancer fighting factors that may play a role in the destruction of cancer cells or whether it is an effective preventive agent.  

Daily supplements of the chlorophyll derivative, chlorophyllin (CHL) can provide a way to prevent cancer by reducing DNA damage  (Arbogast, 1995).   The chlorophyllin copper complex (CHL) is a water-soluble version of chlorophyll and is a semi-synthetic prepared substance.  CHL is the most common chlorophyll derivative used for cancer related studies  (Chernomorsky, 1999).  Most research was done using chlorophyllin because chlorophyll is chemically modified to chlorophyllin in the body during digestion. Chlorophyllin given in amounts to that of chlorophyll were equally effective in the studies  (Sarkar, 1994).  CHL can be added to the diet very easily and may be safe and useful for effective prevention of cancer  (Arbogast, 1995).

Explanation:

Hope this is what you wanted.

What’s the answer ????????

Answers

it’s d
i looked it up and it’s the exact same:)

Answer:

D: Electrons are transferred from one atom to another.

Explanation:

Protons are not involved in the covalency, and C, electrons are shared between two atoms, is the definition of a covalent bond, such as water. Ionic bonds form when two atoms, share (transfer) electrons to one another in order to fill the outer electron ring.

Hope this helps!

At what temperatures can monarch fly?

Answers

Answer:55 degrees

Explanation:In order for an adult monarch to fly, temperatures need to be above 55 degrees Fahrenheit.

Answer:

Temperatures need to be above 55 degrees Fahrenheit.

Explanation:

What field of forensics do medical coroners work in?
O Forensic sociology
O Forensic pathology
O Forensic entomology
O Forensic psychiatry

Answers

the answer should forensic pathology :) my apologies if wrong but that should be it

Answer:

THE ANSWER is B

Explanation:

i need to poop

The field of Astronomy is not related to technology
O True
False

Answers

Answer:

false

i hope this helps and goodluck!

science is so confusing to me!

Select all answers that are correct.

If people have never observed matter (mass) to be created or destroyed, then using inductive reasoning, it would be logical to conclude that:


the known laws of science cannot account for the origin of mass
the amount (quantity) of mass in the universe has never changed
the mass of the universe must have created itself

Answers

Answer:

second one.

Explanation:

not sure but it's the only answer that goes with the other laws

Which of the following is a term use to describe a mound, hill of ridge of wind-blown sand?
A.peak
B.hill
C.contour
D.dune​

Answers

The answer is D.dune


What problems can pseudoscience cause for society?

Answers

Answer:

It is quite difficult to picture a pseudoscientist—really picture him or her over the course of a day, a year, or a whole career. What kind or research does he or she actually do, what differentiates him or her from a carpenter, or a historian, or a working scientist? In short, what do such people think they are up to?

… it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

The answer might surprise you. When they find time after the obligation of supporting themselves, they read papers in specific areas, propose theories, gather data, write articles, and, maybe, publish them. What they imagine they are doing is, in a word, “science”. They might be wrong about that—many of us hold incorrect judgments about the true nature of our activities—but surely it is a significant point for reflection that all individuals who have been called “pseudoscientists” have considered themselves to be “scientists”, with no prefix.

Question 6 of 20
A girl swings a yo-yo around in circles. How can she increase the total energy
of this system?
O
A. Reverse the direction of the swing,
O
B. Stand on a table while swinging the yo-yo.
C. Sit on the ground while swinging the yo-yo.
о
D. Swing the yo-yo at a lower speed,
SUBMIT

Answers

Answer:

it's B

Explanation:

A girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

What is Yo-yo?

Yo-yo may be defined as a type of toy that consists of a pair of joined discs with a deep furrow between them in which thread is attached and wound.

By reversing the direction of the swing, swinging the yo-yo at a lower speed, and sitting on the ground while swinging the yo-yo decrease the total energy of the system. This is because the system does not have the momentum that is required to increase its overall energy.

Therefore, a girl can increase the total energy of this system by standing on a table while swinging the yo-yo. Thus, the correct option is B.

To learn more about Total energy of the system, refer to the link:

https://brainly.com/question/478253

#SPJ5

Example of reproduction

Answers

Answer:

a deer giving birth to a baby deer

what are thylakoids? I will give BRAINLIEST!!

Answers

Answer:

each of a number of flattened sacs inside a chloroplast, bounded by pigmented membranes on which the light reactions of photosynthesis take place, and arranged in stacks or grana.

Thylakoids are membrane-bound compartments inside chloroplasts and cyanobacteria. They are the site of the light-dependent reactions of photosynthesis. Thylakoids consist of a thylakoid membrane surrounding a thylakoid lumen. Chloroplast thylakoids frequently form stacks of disks referred to as grana.

Explanation:

Answer:

They are membrane-bound compartments inside chloroplasts (the food producers of the cell) and cyanobacteria (group of photosynthetic bacteria).

which of the following statements are true?
A. Flavr Savr tomatoes are still commercially successful.
B. A large percentage of US crops are currently genetically engineered.
C. Glyphosate kills all plant life, even genetically altered plants.
D. None of these are true

Answers

B! we had to alter them to our preferred taste and nutrients

*MAY* give brainliest!

Please give answer and explain:

This sequence encodes for a particular protein that helps bacteria move. A mutation occurs in the sequence, leading to a faulty protein. Identify the sequences where the mutation might have taken place.

ATTTGCATACTACCGGGC

The letters in bold with a yellow highlight are the noncoding region, and the other letters are the protein coding region.

Group of answer choices

ATTTGCAATACTACCGGGC

ATGAATGCATACTACCGGGC

ATTTGCATACTGACCGGGC

ATTTGCAACTACCGGGC

ATTAGCATACTACGGGC


Highlighted letters are: ATACTACC

Answers

Answer:

1 and 5

Explanation:

https://brainly.com/question/11362587?utm_source=android&utm_medium=share&utm_campaign=question

Answer:

1.ATTAGC(ATACTAC)GGGC

5. ATGAATGC(ATACTACC)GGGC

What does “denature” mean in terms of protein structure?

Answers

Explanation:

Denaturation, in biology, process modifying the molecular structure of a protein. Denaturation involves the breaking of many of the weak linkages, or bonds (e.g., hydrogen bonds), within a protein molecule that are responsible for the highly ordered structure of the protein in its natural (native) state.

Other Questions
PLEASE HELP WILL MARK BRAINLIEST True or FalsePlease help mehViruses can fly in droplets of moisture 1) Completa las oraciones con las formas correctas de los verbos regulares.Please do not capitalize your answers. No accents are required.1. Cada da yo me (levantar) a las seis y media. *This is a required question2. Primero, (comer) el desayuno. *3. Despus, me pongo la ropa y me (cepillar) los dientes. *4. Como mi escuela queda tan cerca a mi casa, mis hermanos y yo (caminar) all. *5. Cuando nosotros (llegar), *6., (hablar) con los amigos antes de empezar las clases. *7. Mi maestro de matemticas es el Sr. Bonacum, y yo (recibir) notas buenas en su clase. *8. En mi clase de literatura, los estudiantes (escribir) composiciones. *9. Los estudiantes tambin (leer) novelas. *10. Mi clase favorita es el arte. En esta clase yo (dibujar), *11. yo (pintar), *12. , y (aprender) sobre artistas importantes. *2) Completa el dilogo con las formas correctas de los verbos que cambian de raz.This verbs have a change in the first part and in the ending. Do not capitalize your answers.1. Camarero: Hola, seor. En qu (poder) servirle? *2. Cliente: Ustedes (tener) algunas especialidades de la casa? *3. Camarero: S, hoy nosotros (servir) un pescado ahumado con verduras. *4. Cliente: Pues, (querer) mucho una comida picante.... *5. Camarero: Si le gusta la comida picante, le (recomendar) el plato tpico. *6. Cliente: Cunto (costar) el plato tpico? *7. Camarero: Cuesta diez dlares. Por qu no lo (probar) usted? *8. Camarero: Muchos clientes me (contar) que es delicioso. *9. Cliente: Bueno, entonces (pedir) el plato tpico. *10. Camarero: Muy bien, seor, yo (volver) en seguida. * WILL GIVE BRAINLIEST!! What is the y-intercept of a line that has a slope of 3 and passes through point (4, 8)? please help me asap (picture is included) (: Who was the first mughal empire The Dawes Commission was originally only successful in getting the___ tribe to agree to individual land allotment.A. CreekB. ChoctawC. ChickasawD. Seminole URGENT PLEASE I URGENTLY NEED HELP I REALLY DONT WANT TO FAIL Find the common ratio of the geometric sequence 18,-90,450,... 6. What are the bonds called between two hydrogen atoms? what is the Confederacy fighting for? *How can I find the sum of -5 + 12 using a vertical number line? * A. Start at 5 and move 12 units down. -5 + 12 = -7 B. Start at 12 and move 5 units up. -5 + 12 = 17C. Start at 5 and move 12 units up. -5 + 12 = 17D. Start at -5 and move 12 units up -5 + 12 = 7 The density of a gas is 0.88 g/mL. What is the mass of 500.0 mL of this gas? Help!!Which is equivalent to 5/1215^x What is the solution for the equation 6x 8 = 4x? x = . (Input whole number only). (5 points) Blank 1: Two cups are mathematically similar. The larger cup has capacity 0.5 litres and height 8cm. The smaller cup has capacity 0.25 litres. Find the height of the smaller cup karinne hit 4 more home runs than 1/2 the number of home runs Lu hit. Together they hit 10 home runs. Let X represent the number of home runs Lu hit. Write an equation to represent the situation A fruit company includes 1.655 ounces of pineapple juice in a 6.75 ounce bottle of a mixed fruit juice. How much of the bottle of mixed fruit juice is NOT pineapple juice? Aerobic exercise means 'with oxygen! It's also the same thing as saying cardiovascular exercise, cardiorespiratory exercise, and just plain cardio. True False What does a seismograph measure?a)the vibrations produced by an earthquakeb)the total amount of energy released by an earthquakec)the amount of damage that results from an earthquaked)the distance from the epicenter of an earthquake