ACTIVITY 1
Multiple Choice: Choose the letter of the correct answer
1 It is all about discovering and satisfying your customers' needs and want while earning
a profit
A Marketing
B. Product C Promotion D Needs
2. These are the bundles of attributes and benefits designed to be offered to buyers to
satisfy their needs, wants, and demands
A Promotion B Products C Customer D Market
3 Making sure that they are specific and quantifiable so you can measure your progress
toward achieving them, belong to what step of marketing?
A Marketing objective B Identifying demographics C Defining place
4. What steps of marketing plan where you're referring to the entire set of activities that
inform people about your product/service?
A Marketing objective
B Choose your promotion strategy
C Develop a pricing strategy
5 Defined as the difference between what the customer gains from the product and what
the customers losses from the costs acquiring such a product
A Market
B Customer Value C Promotion​

Answers

Answer 1

Answer:

A. Marketing.B. Products.A. Marketing objectiveB. Choose your promotion strategyB. Customer Value.

Explanation:

Marketing is all about knowing what the customer wants and satisfying it by offering the relevant products.

Products are simply bundles of benefits that were designed to be able to satisfy the needs and wants of customers.

The marketing objectives specify what the goals need to be achieved when marketing so comparing reality against them helps show progress.

The promotion strategy shows the activities that will be undertaken during the marketing of your goods and services.

Finally, the customer value from a product is simply what benefit the customer received less the cost of receiving that benefit.


Related Questions

Stanley is 21 years of age, single, living at home with Mom, Dad, and his younger sister, but he is not claimed by his parents. Stanley worked at Hot Dog Heaven and earned $9,325 in 2018 and filed a federal1040 tax return. He plans to attend college full-time. What documents does he need to complete his FAFSA application?

Answers

The document that he needs to complete his FAFSA application is D. None of the above.

FASFA Application is an acronym for The Free Application for Federal Student Aid. This is an application that is done that allows students to be considered for Federal student aid.

The documents that a student needs to complete his FAFSA application include one's security number, the Federal Income tax returns, and every other record of the money that the person has earned.

From the complete question, none of the above options are given, therefore, the correct option is None of the above.

Read related link on:

https://brainly.com/question/24962716

Tari is a human resource manager at a software company. She receives a call from an HR manager at another software company asking about Misha, a software engineer who used to work at the company and has applied for a job at the caller's company. Tari checks the company's records and sees that a co-worker had accused Misha of racial discrimination, but an investigation did not turn up any evidence to support the charge. Misha left the company two months later, saying she was no longer comfortable there. Tari is concerned about sharing the details of this situation with the caller. If telling the information to the caller leads to the other company not hiring Misha, what potentially unlawful behavior could Misha accuse the company of engaging in

Answers

The potentially unlawful behavior that  Misha could accuse the company of engaging is Defamation or Misrepresentation

 

Defamation  occur when a person give out wrong information or misleading information about another person that may  damage the reputation of the person.

Based on the give scenario there was no any form of evidence  to support the charge  that Misha was a racial discriminatory.

Which means that if Tari shared  what transpired with the caller it my damaged Misha reputation which will inturn may affect her career.

Assuming  Tari later explained what transpired to the caller which  leads to the other company not hiring Mirah it means Tari has engaged in unlawful behavior of tarnishing Misha reputation hence, Misha  could accuse the company of engaging in defamation of character.

Inconclusion The potentially unlawful behavior that  Misha could accuse the company of engaging is Defamation or Misrepresentation.

Learn more here:

https://brainly.com/question/15863456

factors such as the increasing number of women in the workforce and the growing number of older workers exemplify which force for change outside the organization?

Answers

Answer: demographic characteristics

Explanation:

Which of the following accurately defines tolerance in the context of measurement?

A. Ability to convert measurements based on the situation

B. Permissible deviation from a specified measurement

C. Process of adjusting measurement devices

D. System of ranking the precision of measurements

Answers

Answer:

B:Permissible deviation from a specified measurement

Explanation:

Permissible deviation from a specified measurement accurately defines tolerance in the context of measurement. Thus, option B is the correct option.

What is tolerance?

Tolerance is used to describe the provision of an appropriate range of admission from ideas, deeds, or behaviors that someone considers to be morally repugnant but still “tolerated,” because those who should not be outlawed or restricted are those who should be tolerated.

The word “tolerance” throughout the context of measuring refers to the spread seen between the highest and lowest proportions with permitted mistakes. Tolerance is another name for a legally permissible range of flaws, such as quality requirements.

Tolerance in the setting of assessment is defined as that of the allowed variance of a given measurement. Therefore, option B is the correct option.

Learn more about Tolerance, here:

https://brainly.com/question/28199476

#SPJ2

which government branch creates the federal tax law

Answers

The answer is Congress :)

The government branch that create the federal tax law is : Congress.

What is a congress?

Congress refers to the legislative arm of the federal government that represents the American people and also make the nation's laws. Congress shares power with the executive branch, led by the president, and the judicial branch.

A congress would have the following:

Very strong powers, which will enable it to execute its policies without hindrances.A good representation and understanding of the general opinion to be able to execulte the policies that people will actually want.A good understanding of the effects and consequences of the policies it executes

Hence, the government branch that create the federal tax law is Congress.

Learn more about congress here : https://brainly.com/question/779570

Stan works from home in Louisiana. His company is located in Washington. This work arrangement is
called

distance working

distant employment

nationwide employment

telecommuting

Answers

Answer:

telecommuting bc it's remote

Explain the tool of monetary policy a government could use to gain positive balance of payment

Answers

Answer:

What is the tool of monetary policy?

Central banks have four main monetary policy tools: the reserve requirement, open market operations, the discount rate, and interest on reserves. 1 Most central banks also have a lot more tools at their disposal. Here are the four primary tools and how they work together to sustain healthy economic growth.

Explanation:

Suppose the central bank in the nation of Zook attempts to pay off its national debt by printing large amounts of currency. The large increase in the money supply causes the price level to rise by 1,200 percent. What do you expect will happen to the value of Zook's currency?




Instructions: Round your answer to 2 decimal places.




The value of Zook's currency will

(Click to select)

by

percent.

Answers

Answer:

it would become worthless

Explanation:

if they keep printing loads of money then the individual Zook dollar would decrease in worth

Which is NOT a main goal of advertising?
To evaluate: gives a company a measure of how many customers it reaches.
To persuade: shows why the brand is the best.
To inform: introduces a brand new company, product, or service.
To remind: reinforces the brand message.

Answers

Answer:

to remind

Explanation:

because you need to persuade people and inform people and before you do that you have to evaluate

Tasty Tangerine is currently selling 50,000 boxes for $25 per box. Variable cost per box is $17 and fixed costs total $260,000. A plan is being considered to spend $60,000 on advertising and reduce the selling price by $2 per box. Management believes the advertising along with the price reduction will increase sales volume by 24,000 boxes. If management's predictions are correct, making these changes will cause net income for the year to

Answers

Based on the changes,Tasty Tangerine's net income for the year will decrease by $16,000 from $140,000 to $124,000.

Data and Calculations:

Current sales unit = 50,000 boxes

Selling price per box = $25

Variable cost per box = $17

Total Fixed costs = $260,000

Contribution margin = $8 ($25 - $17)

Net income based on current sales plan = $140,000 ($8 x 50,000 - $260,000)

New Plan's sales units = 74,000 boxes

Selling price per box = $23 ($25 - $2)

Variable cost per box = $17

Total Fixed costs = $320,000 ($260,000 + $60,000)

Contribution margin per box = $6 ($23 - $17)

Net income based on new plan = $124,000 ($6 x 74,000 - $320,000)

Thus, the changes will cause Tasty's net income for the year to decrease by $16,000.

Learn more: https://brainly.com/question/6838514

snowcap ice cream produces over a dozen delicious ice cream flavors and a number of individually packaged frozen treats. which of these strategies would represent vertical integration for snowcap?

Answers

The purchase of Mountain Dairy milk farm would represent a vertical integration for Snowcap.

Vertical integration refers to the process of acquiring the business operations of another in order to increase supply chain efficiency and to achieve reduction of delays.

Here, the Snowcap company produces ice creams and requires the milk to facilitate its production. Therefore, the company can buy a milk plant, to enable its control the delivery of milk to the ice cream plant.

Therefore, the purchase of Mountain Dairy milk farm would represent a vertical integration for Snowcap.

Multiple Choice "a. purchasing Mountain Dairy milk farm, b. acquiring a beverage bottling plant, c. opening a personal tax accounting division, d. setting their prices lower than the competitors’ prices"

Learn more about Vertical Integration here

brainly.com/question/10518340

why will the coefficient for the price elasticity of demand always be a negative number?

Answers

The coefficient for the price elasticity of demand is normally negative because the demand curve is downward sloping.

Price elasticity of demand:

Shows how quantity demanded changes as a result of a change in price Is calculated by dividing the change in quantity demanded by the change in price

For normal goods, an increase in price leads to a decrease in quantity demanded. This is why the demand curve is downward sloping. If price goes up, quantity demanded will go down.

This change in quantity demanded will be shown as a negative number which means that when it is divided by the change in price, the price elasticity coefficient will be negative.

In conclusion, the price elasticity coefficient is usually negative because the demand is negative when prices increase.

Find out more at https://brainly.com/question/24261490.

Identify and explain two ways in which managers could use information obtained in the income statement?

Answers

Answer:

An income statement is one of the three major financial statements that reports a company's financial performance over a specific accounting period.

Explanation:

a customer of a bank is skiing at her favorite ski resort. as she is riding the ski lift, her cell phone dings with a text reminding her to pay her credit card in the next few days before the deadline. she really enjoys how her bank sends her reminders and timely messages, and this builds her loyalty to the bank. this example illustrates which unique attribute associated specifically with digital marketing?

Answers

Answer:

mobile and portable

Explanation:

This illustrates mobile and portable unique attributes associated specifically with digital marketing.

What is illustration?

A decoration, interpretation, or visual explanation of a text, concept, or process is called an illustration. Illustrations are made to be integrated into print and digitally published media, including posters, flyers, magazines, books, instructional aids, animations, video games, and films

When promoting goods and services, digital marketing makes use of the Internet and other online-based technology such as desktop computers, mobile phones, and other digital media and platforms.

Therefore, Product attributes are traits or qualities that characterize a good. These qualities can be tangible,

Learn more about illustration here:

https://brainly.com/question/1462956

#SPJ6

Which person used a cost-saving strategy when deciding how to spend their money?

a. when selecting a new tablet, Rosita carefully read about the features of each model.

b. when purchasing a new jacket, Thao chose the one that was manufactured locally.

c. when choosing which coffee to buy, Ivan chose the brand with the "fair trade" label.

d. when buying a used dirt bike, Fabian negotiated with the seller to get a better deal.

will give brainliest!

Answers

d. when buying a used dirt bike, Fabian negotiated with the seller to get a better deal.
(cost-saving)

The person who used a cost-saving strategy when deciding how to spend their money is the Fabian who negociated with the seller to buy a used dirt bike to get a better deal.

What is cost-saving stategy?

The strategy in which we analysis the basic requirements which are necessary and on which minimum cost can be made in a business

What is a dirt bike?

The bikes which are generally used in dirts to have races or to have friction with the roads with dirts.

Hence, option D is the correct answer

To know more about Cost saving strategy, click here

https://brainly.com/question/17100091

#SPJ2

do you want high or low interest rate on loan/credit explain

Answers

Answer:

Low interest rate is better because you will payback less

Explanation:

Buying something in order to increase social status is known as ______consumption.

Answers

Answer:

conspicuous consumption

❗WILL GIVE BRAINLYLEST❗Susan Works for a company that values their employees meetings deadlines and finding ways to keep the cost of doing business low. What quality standard does Susan's company value?
.

A. Efficiency
B. Diversity
C. Accountability
D. Workplace Safety​

Answers

Answer: A: efficiency

Explanation:

your welcome

Susan works for a company that places a high importance on meeting deadlines and finding ways to keep operating expenses to a minimum. Therefore, option (A) is accurate.

What do you know about Diversity factor?

Due to this dependency or "diversity" in time, the diversity factor acknowledges that the whole load is not equal to the sum of its parts. In a facility with 10 20-ton air conditioners, for instance, the average full load equivalent running hours per year would be 2000.

It is unknown exactly when each unit goes on because they are all thermostatically controlled. The likelihood of fewer than all ten units turning on simultaneously increases if the ten units are significantly more than the facility's actual peak AC demand.

Thus, despite the fact that each unit works for a total of 2,000 hours each year, they do not all turn on at once to operate.

Learn more about Diversity factor, from :

brainly.com/question/2572749

#SPJ5

in which step of the l&d process do managers determine what skills employees should have after the process that they did not have before?

Answers

The learning and development process refers to the steps taken by the employers of labor to equip their employees with the knowledge they need to succeed. The stage in which managers determine what skills employees should have after analyzing the skills that they did not have before is;

The Training Needs Analysis or Skills Assessment stage

Before training employees on certain skills, there should be an evaluation of what they knew before.

When their present skills are determined, it becomes easy to identify the gaps and fill them in through training.

So, the Skills Assessment stage, which is the second stage after Role-based Competency Mapping is applicable.

Learn more here:

https://brainly.in/question/12774795

what approach to strategic hrm deploys bundles of internally consistent hr practices to improve employee ability, motivation, and opportunities across the entire organization?

Answers

The "High performance work system" is the approach deployed by Human resources manager to improve employee ability, motivation, and opportunities.

Basically, the Human resources manager belongs to the department which is responsible for motivating and ensuring the well-being of employees so that productivity can be achieved at the workplace.

The High performance work system is the type of system that creates an environment which allows the employees to be greatly involved in activities which with greater responsibility.

The HRM deploys the HPWS because its allows the employees to feel and take more responsibility for improving the organization's products, services and processes.

Learn more about HPWS here

brainly.com/question/22971644

under the concept of establishment of responsibility, how many people should have the ultimate responsibility?

Answers

Answer:

1

Explanation:

because we smart,im from forest hill

Answer:

1 because he or she can lead a group

if the activity level increases 10%, total variable costs will

Answers

If activity level increases by 10%, total variable costs will increase by 10%. It remains the same per unit at every level of activity. remain the same in total regardless of changes in the activity level. ... The CVP income statement classifies costs as variable or fixed and computes a contribution margin. I hope this helps!!

Please hurry I will mark you brainliest

List the order of Maslow's Hierarchy of Needs from both to top. Briefly explain the needs and wants to be fulfilled at
each level. Why does this order exist?

Answers

In order to better understand what motivates human beings, Maslow proposed that human needs can be organized into a hierarchy.

Maslow organized human needs into a pyramid that includes (from lowest-level to highest-level) physiological, safety, love/belonging, esteem, and self-actualization needs.

Physiological needs - these are biological requirements for human survival, e.g. air, food, drink, shelter, clothing, warmth, sex, sleep.

If these needs are not satisfied the human body cannot function optimally. Maslow considered physiological needs the most important as all the other needs become secondary until these needs are met.

2. Safety needs - once an individual’s physiological needs are satisfied, the needs for security and safety become salient. People want to experience order, predictability and control in their lives. These needs can be fulfilled by the family and society (e.g. police, schools, business and medical care).

For example, emotional security, financial security (e.g. employment, social welfare), law and order, freedom from fear, social stability, property, health and wellbeing (e.g. safety against accidents and injury).

3. Love and belongingness needs - after physiological and safety needs have been fulfilled, the third level of human needs is social and involves feelings of belongingness. Belongingness, refers to a human emotional need for interpersonal relationships, affiliating, connectedness, and being part of a group.

Examples of belongingness needs include friendship, intimacy, trust, and acceptance, receiving and giving affection, and love.

4. Esteem needs are the fourth level in Maslow’s hierarchy and include self-worth, accomplishement and respect. Maslow classified esteem needs into two categories: (i) esteem for oneself (dignity, achievement, mastery, independence) and (ii) the desire for reputation or respect from others (e.g., status, prestige).

Maslow indicated that the need for respect or reputation is most important for children and adolescents and precedes real self-esteem or dignity.

5. Self-actualization needs are the highest level in Maslow's hierarchy, and refer to the realization of a person's potential, self-fulfillment, seeking personal growth and peak experiences. Maslow (1943) describes this level as the desire to accomplish everything that one can, to become the most that one can be.

Individuals may perceive or focus on this need very specifically. For example, one individual may have a strong desire to become an ideal parent. In another, the desire may be expressed economically, academically or athletically. For others, it may be expressed creatively, in paintings, pictures, or inventions.

PLEASE BRAINLIEST IT WOULD MEAN A LOT :)

A supererogatory act is an act that is beyond the call of duty.
True
False

Answers

the answer is .... TRUE

please give me brainliest answer!! ☺️

which of these starbucks® coffees was the very first blend we released

Answers

A blend of fine Latin American beans roasted to a glistening, dark chestnut color. Loaded with flavor, balancing tastes of toffee and cocoa, just a touch of sweetness from the roast.

According to Starbucks, the starbucks® coffee that was the very first blend released is " a mix of excellent Latin American beans seared to a glistening, murky chestnut color."

These delicious Latin American beans are prepared with a combination flavor of toffee and cocoa.

Starbucks first prepared this variety in 1971 when the company commenced production in Seattle.

Starbucks is one of the most popular coffee producers in present-day America.

Hence, in this case, it is concluded that the starbucks® coffee that was the very first blend released is " a mix of delicious Latin American beans seared to a glistening, murky chestnut color."

Learn more here: https://brainly.com/question/20533939

A mutual fund Select one: a. is an institution that sells shares to the public and uses the proceeds to buy a selection of various types of stocks, bonds, or both stocks and bonds. b. is a financial market where small firms mutually agree to sell stocks and bonds to raise funds. c. sells stocks and bonds on behalf of small and less known firms who would otherwise have to pay high interest to obtain credit. d. is funds set aside by local governments to lend to small firms who want to invest in projects that are mutually beneficial to the firm and community.

Answers

Answer:

c

Explanation:

sells stocks and bonds on behalf of small and less known firms who would otherwise have to pay high interest to obtain credit. d. is funds set aside by local governments

1 points Time Remaining 3 hours 32 minutes 11 seconds03:32:11 eBookPrintReferencesItem 31 Time Remaining 3 hours 32 minutes 11 seconds03:32:11 A __________ is a private investment pool open only to wealthy or institutional investors that is exempt from SEC regulation and can therefore pursue more speculative policies than mutual funds.

Answers

Hedge fund refers to that investment vehicle which serves only for the accredited investors, high class institutional investors and high net worth individuals. They hold the greatest risk and try to achieve highest return among all.

Probably a stock because people can invest in it not too sure about private but yea

in markets, prices move toward equilibrium because of

Answers

Answer:

"The market price moves toward equilibrium because of the actions of the buyers and sellers in the market. Suppose there is a surplus in the market which means that supply is more than the demand. ... Similarly, when there is a shortage and price increase and a new equilibrium is achieved."

Explanation:

Jim lost his job in a car assembly factory to a robot and his skills will no longer be needed. Which terms can be used to describe Jim? Check all that apply.cyclically unemployeddomestically unemployedfrictionally unemployedstructurally unemployedstill employedunemployed

Answers

When Jim lost his job, he became unemployed and structurally unemployed.

A person is unemployed if he is within the working age, is willing and able to work but does not have a job.

Types of unemployment

Structural unemployment: this type unemployment occurs when the skills a person has is no longer relevant in the economy. It occurs as a s result of changes in the economy. For example, technological advancement can make a person's job redundant.

Frictional unemployment:  this type of unemployment occurs from when a person leaves his current employment gets another job.  

Voluntary unemployment: a person decides not to work. For example, a factory worker might decide to stop working in order to become a fulltime student.

Cyclical unemployment: it occurs as a result of fluctuations in the economy.

To learn more about unemployment, please check: https://brainly.com/question/4479360?referrer=searchResults

How do you think the company’s motto ""Do what you like. Like what you do"" might affect how managers manage? Be specific

Answers

Answer:

This motto will encourage the managers to love their job which results in a higher performance

Explanation:

Other Questions
need explanation with these problems! help me please! Sort the cultural values and beliefs about women into the appropriate categories. Decide whether each was commonbefore or after changes in the late 1800s. Pls help. I will give you 10 points! Can somebody help me asap pls help me i will give 30 points help me pls don't type random letter or I will report u ty 1. Vamos a hacer un picnic en el parque hoy.A. lllgicoB. Lgico2. El primer da del ao es un da festivo, pero ese da casi todo el mundo est cansado! A. lllgicoB. Lgico3. La familia de Migdalia es enorme. Tiene parientes en casi todo el Mxico.A. lllgicoB. Lgico4. El beb de Sofa cumpli ayer 29 aos. Es muy simptico! A. lllgicoB. Lgico5. Muchos bebs tienen la costumbre de llorar cuando tienen hambre.A. lllgicoB. Lgico6. Qu desastre! Ayer fue el cumpleaos de Julio Andrs y se me olvid felicitarlo!A. lllgicoB. Lgico7. Una persona educada es una persona que no tiene buenos modales. A. lllgicoB. Lgico8. La fiesta de sorpresa para la Srta. Gutirrez fue excelente. Ella nos ayud a prepararla!A. lllgicoB. Lgico9. La abuelita de mi amiga Idalia naci hace dos das.A. lllgicoB. Lgico10. Alrededor del museo haba estatuas antiguas y modernasA. lllgicoB. LgicoHelp please Suzie looked at the diagram at right and wrote 134%=134/200. Is she correct? It is important to consider the social, emotional, physical, and economic effects of teen pregnancy on the teen parent, the child, the family, and society. Think about your goals for the future and how they could be affected by teen pregnancy. Use this decision-making process document to help brainstorm your ideas and organize your thoughts. Then respond to the prompt. the half-life of roentgenium -281 is 17 seconds,if 10 grams are left after 85 seconds,how many grams were initially in the original sample? Find the midpoint of the line segment with endpoints (-3, 2) and (1.-2)A)(-1,0)B)(0, -1)(-2,0)D)(0, -2) The radius of a circle is 11 millimeters. What is the circle's circumference? Select the correct answer.In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?Group of answer choices1. TATTCATTCATTATGATTTATTCG2. TATTCATTGTTATGATATTCG3. TGCATTCATTGTTATGATTTATTCG4. TATTCATTGTTATGACTTTATTCG5. TATTCATTGTTATGATTTATTGGCG The Know-Nothing Party opposed which of the following? 1) What is your Dawn Wall and how are you approaching it? What is the expected outcome? (Or, reflect on a 'Dawn Wall' in your past and discuss how you overcame it.)2) Describe a few things that Kevin and Tommy had to overcome to realize their goal. (Or, describe what things had to be in order or exist for their goal to be realized.) Which of the following ions is formed when a base is dissolved in a solution? H+ O OH SO42+ 1) What percentage of oxygen and carbondioxide inhaled and Exhaled Air ? .. A. Suriin kung anong panghalip panao na ginagamit sa pangungusap.1. Sila ay magsisimba.2. Hiniwa niya ang tiyan ng manok.3. Ako ay mag-aaral sa Tiptip ng Elementarya.4. Ikaw ay kasama ko. why is this wrong and what is the right answer? Which statement describes Keplers third law of orbital motion?