△ABC and △JKL are two triangles such that ∠A≅∠J and ∠B≅∠K. Which of the following would be sufficient to prove that the triangles are congruent? A ACJL=BCKL B ∠C≅∠L C AB≅JK D BC≅Jk

Answers

Answer 1

We need to know the rules of congruence of triangles to solve the given problem. The required condition that is sufficient to prove that the triangles are congruent is option (C) AB≅JK.

There are three rules of congruence of triangles, if two triangles satisfy any one of these rules then we can say that the triangles are congruent.  The three rules are, SSS which means three sides are equal, ASA which means two angles and their corresponding sides are equal and SAS which means that two sides and the angle between them is equal. When two angles are said to be congruent it means they have the same measure that is they are equal. In this question we know that ∠A≅∠J and ∠B≅∠K , we can see that two angles are equal, if we can have the corresponding side of these two angles to be equal then we can say that the two triangles are congruent. The corresponding side of these angles are AB and JK.

Therefore we can see that the required condition to prove that the triangles are congruent is option (C) AB≅JK.

Learn more about congruency of triangles here:

https://brainly.com/question/2736828

#SPJ1


Related Questions

Given that
7
x

2
y
=
35

Find
y
when
x
=

9

Answers

Answer:

y = - 49

Step-by-step explanation:

Given

7x - 2y = 35 ← substitute x = - 9 into the equation

7(- 9) - 2y = 35, that is

- 63 - 2y = 35 ( add 63 to both sides )

- 2y = 98 ( divide both sides by - 2 )

y = - 49

Answer:

[tex]\boxed{y = -49}[/tex]

Step-by-step explanation:

=> [tex]7x-2y = 25[/tex]

Given that x = -9

=> [tex]7(-9)-2y = 35[/tex]

=> [tex]-63 -2y = 35[/tex]

Adding 63 to both sides

=> [tex]-2y = 35+63[/tex]

=> [tex]-2y = 98[/tex]

Dividing both sides by -2

=> [tex]y = 98/-2[/tex]

=> [tex]y = -49[/tex]

What is the solution to the system of equations below? 2 x + 3 y = 17. 3 x + 6 y = 30. (Negative 7, 24) (3, 4) (4, 3) (24, Negative 7)

Answers

Answer:

work is shown and pictured

Answer:

C

Step-by-step explanation:

Brainliest?

3x-y+2=0 in rectangle form

Answers

Complete Question:

Convert 3x-y+2=0 in rectangle form to polar form

Answer:

r ( 3cosθ - sinθ) = -2

Step-by-step explanation:

The equation so given is already in rectangular form, the task is to convert it to polar form.

3x - y + 2 = 0

To transform an equation from the rectangular to the polar coordinate:

x = r cosθ

y = r sinθ

Substitute the representations for x and y into the given equation:

3(r cosθ) - (r sinθ) + 2 = 0

3rcosθ - rsinθ = -2

The polar representation of the equation then becomes:

r ( 3cosθ - sinθ) = -2

State if the gives angles are coterminal.

Answers

Answer:

Below

Step-by-step explanation:

Coterminal angles are angles with same terminal angles

Mathematically speaking these angles should have the same coordinates in a trigonomitrical circle

●●●●●●●●●●●●●●●●●●●●●●●●

Angles like 0° and 360° are coterminal since to we made a spin from 0° to 360°

For two angles A and B to be coterminal they should verify this relation :

A = B + k*360° with k an integer

So A-B = k*360°

●●●●●●●●●●●●●●●●●●●●●●●●

7) :

35° and 395°

395° -35° = 360°

360° is a multiple of 360° so these angles are coterminal

8) :

140° and 860°

860° - 140° = 720°

720° is a multiple of 360°

720 = 360° × 2

9) :

350° and -710°

350 -(-710) = 350+ 710 = 1060°

1060° isn't a multiple of 360°

So these angles aren't coterminal

10) :

130° and -230°

130 -(-230) = 130+230 = 360°

So these angles are coterminal

11) :

30° and -690°

30 -(-690) = 30+ 690 = 720°

720 is a multiple of 360 so these angles are coterminal

12) :

210° and 10°

210-10 = 200

200 isn't a multiple of 360 so these angles aren't coterminal

what is the inverse of the fuction f(x)=19/x

Answers

Answer:

[tex]f^-^{1} (x)=\frac{19}{x}[/tex]

Step-by-step explanation:

To find the inverse of this function, switch the variables like this:

[tex]\frac{19}{x}\\\\x=\frac{19}{y} \\[/tex]

Then, solve for y, like this:

[tex]y= \frac{19}{x} \\[/tex]

Replace y with [tex]f^-^{1} (x)[/tex].

[tex]f^-^{1} (x)=\frac{19}{x}\\[/tex]

!!geometry! Find the value of x if m∠P=18°

Answers

Answer:

x = 72

Step-by-step explanation:

If P is 18 degrees and Q is 90 degrees you just add them up and subtract it by 180.

9. Read the following word problem, then create a linear equation to model the problem. Provide work to show how your linear equation models the problem, such as a brief description, a picture, or a table. Finally, use the linear equation you created to solve the problem.

$2400 is divided between two accounts. One account pays 2% interest, while the other account pays 3.5% interest. At the end of one interest period, the interest earned is $81. How much was invested in each account?

Answers

Answer:

$200 at 2%.

$2200 at 3.5%.

Step-by-step explanation:

Let the two amounts be x and y.

x earns 2% interest, and y earns 3.5% interest.

Since the total is $2400, then

x + y = 2400

Now we can solve for y and express the second amount in terms of x.

y = 2400 - y

The two amounts are x and 2400 - x.

In one interest period, the amount of interest earned is the amount of money in the account multiplied by the interest.

2% = 0.02; 3.5% = 0.035

The x amount earns 0.02x interest.

The y amount earns 0.035y interest.

The total interest earned is the sum of the interest amounts of the two accounts.

0.02x + 0.035y

We now replace y with 2400 - x, and we set the sum of the interest amounts equal to the total interest earned, $81.

0.02x + 0.035(2400 - x) = 81

The equation above is the linear equation.

Now we solve it. Distribute on the left side.

0.02x + 84 - 0.035x = 81

Combine like terms on the left side.

-0.015x + 84 = 81

Subtract 84 from both sides.

-0.015x = -3

Divide both side by -0.015.

x = 200

$200 was deposited in the account earning 2%.

y = 2400 - x

y = 2400 - 200

y = 2200

$2200 was deposited in the account earning 3.5%.

What equation of the circle would center (-3.2 , -2.1 ) and radius 4.3 ? ( fast please I will give u brainlest)

Answers

Answer:

Look at the attached picture

Step-by-step explanation:

It is given that the center of the circle is (-3.2,2.1) and radius is 4.3.

Answer:

( x+3.2) ^2 + ( y+2.1) ^2 = 4.3^2

Step-by-step explanation:

We can write the equation of a circle as

( x-h) ^2 + ( y-k) ^2 = r^2

where ( h,k) is the center and r is the radius

( x- -3.2) ^2 + ( y--2.1) ^2 = 4.3^2

( x+3.2) ^2 + ( y+2.1) ^2 = 4.3^2

someone please help!!

Answers

Each tick on the graph represents a single unit.

Thus, counting the ticks, we see that the graph starts at x=2. We also see that the graph ends at x=5.

Thus, the domain is [tex]2 \leq x \leq 5[/tex]

Let me know if you need any clarifications, thanks!

Please answer the following questions​

Answers

Step-by-step explanation:

sorry I can only explain as there are no labels to each diagram

The first diagram is single and can solved using triangular formular given as 1/2 ×base × height

A = 1/2 × 5 × 12

A = 30cm^2..

as for the second one...it consist of 2 diagrams which will be solved separately before adding ...it can simply be done using Pythagoras theorem..

To get the smaller part ...out tita is 45degrees while our adjacent is 4 and opposite is x we are to find x which is the height...

using SOH CAH TOA...

WE HAVE TAN45= opp/adj

Tan45= x/ 4

Tan 45 =1 ...so

1 = x/ 4

and x= 4 ...

so...having our height as 4 and base as 4 ..

Area of smaller triangle become 1/2 × 4 × 4

A = 8cm^2 ...

......SOLVING FOR THE SECOND DIAGRAM ..

WE HAVE the height as ( dotted spot + undotted spot ) = 4 + 4 = 8cm

and our base can be gotten from

Tan45 = opp / adj

1 = 8/x ..

x = 8cm ....so the base is 8 and the height is 8

..

The Area becomes 1/2 × 8×8 = 32cm ...

Total area becomes 32cm + 8cm = 40cm^2

Solve this problem. Reduce to lowest terms.
John worked in his garden for 4 3/4hours on Saturday and 2 1/2 hours on Sunday. How
many hours did he work in all?
0 6 hours
O 7 hours
4 hours
5 hours

Answers

4 3/4 + 2 1/2 = 4 3/4 + 2 2/4 = 6 5/4 = 7 1/4 = 6 hours and 15 minutes.

what is the value of the exponent expression below?

Answers

Answer:

6

Option C is the correct option.

Step-by-step explanation:

[tex] {36}^{ \frac{1}{2} } [/tex]

Write the number in exponential form with a base of 6

[tex] =( {6}^{2}) \: ^{ \frac{1}{2} } [/tex]

Simplify the expression by multiplying the exponents

[tex] = 6[/tex]

Hope this helps..

Best regards!!

PLEASE HELP ME with this question! I really need help...

Answers

Answer:

  One of the other perpendicular bisectors must pass through point B

Step-by-step explanation:

Let's look at the choices:

 — incenter equidistant from B and C.

The incenter is on the perpendicular bisector of BC. Every point on that line is equidistant from B and C. This statement is True.

__

 — angles B and C are congruent.

As we said above, A (on the perpendicular bisector of BC) is equidistant from B and C. That makes the triangle isosceles. The congruent angles are B and C, opposite congruent sides AC and AB. This statement is True.

__

 — the perpendicular bisector of BC passes through the incenter.

The incenter is the point of concurrence of the angle bisectors. Since the perpendicular bisector of BC goes through the a.pex of triangle ABC at A, it is the angle bisector there. Hence the incenter lies on that line. The statement is True.

__

 — B lies on one of the other perpendicular bisectors.

This will be true if the triangle is equilateral. Nothing in the problem statement indicates this is the case. The statement is False.

The arm and blade of a windshield wiper have a total length of 30 inches. The blade is 24 inches long and the wiper sweeps out an angle of 125 degrees.

Answers

Answer:

942.5 in²  

Step-by-step explanation:

The formula for the area (A) of a sector of a circle is

A = ½r²θ

where θ is the angle in radians.

1. Convert the angle to radians

θ = 125°  

[tex]\theta = 125^{\circ} \times \dfrac{\pi \text{ rad }}{180^{\circ}} =\frac{25}{36} \pi\text{ rad}[/tex]

2. Area swept out by wiper arm

A = ½r²θ = ½ × (30 in)² × θ = ½ × 900 in²× θ = 450 θ in²

3. Area missed by wiper

A = ½r²θ = ½ × (6 in)² × θ = ½ × 36 in²× θ = 18 θ in ²

4. Area covered by wiper

A = 450 θ in² - 18 θ in² = 432 θ in²

5. Insert the value of θ

A = 432 × 25/36 π in² = 300π in² ≈ 942.5 in²

The area swept out by the wiper blade is 942.5 in².

A recent social survey asked whether respondents believed that Antarctic penguins were
threatened. The responses are summarized in the table below.
Answer Male Female Total
A great deal 123 200
323
Some 150 164 314
Not at all 28 16 44
Total 301 380 681
A respondent is randomly selected among those who believe that penguins are threatened
"a great deal." Approximately what is the probability that this respondent will be female?​

Answers

This question is incomplete because the options are missing; here is the missing section:

A respondent is randomly selected among those who believe that penguins are threatened  "a great deal." Approximately what is the probability that this respondent will be female?​

A. 29%

B. 38%

C. 53%

D. 62%

The correct answer to this question is D. 62%

Explanation:

The general formula to calculate the probability of one simple event is to divide the number of outcomes that will lead to the specific event, by the number of total outcomes. In the case presented, we know the total of people who answered penguins are threatened "a great deal" is 323, which represents the total of outcomes. Additionally, as we need to find out the probability of a respondent in this category is a female, the number of ways this specific event can happen is 200 (total number of female respondents).

This means the probability is equal to 200 (number of female respondents) / 323 (total respondents) which is equivalent to 0.619 or 0.62 if the number is rounded. Additionally, this probability can be expressed as a percentage by multiplying this by 100, which means the probability is 62%.

The slope of a line is -4, and the y-intercept is -3. What is the equation of the line written in slope-intercept form?
Oy= 4x - 3
y=-4x + 3
Oy=-4x - 3​

Answers

Answer:

y=-4x-3

Step-by-step explanation:

y=mx+b

y=b=-3 ( y intercept is when x=0, then y=b=-3)

y=-4x-3

PLEASE HELP!!!

In a survey, 250 adults and children were asked whether they know how to
swim. The survey data are shown in the relative frequency table.

Answers

Answer:

82% Add .34+.48.

Step-by-step explanation:

The question is asking how many people CAN swim. This is why the answer is 82. But if the question asks how many people CANT swim the answer will be 18. This is why some people might get confused.

what is 1 add 1 please help!!!!!!!!!!!!!!!PS first person to get it correct gets brainiest

Answers

Answer: 2

Step-by-step explanation:

Answer:

2...........

Step-by-step explanation:

1 + 1 = 2............

The roots of 100x2 – 20x + 1 = 0 is:​

Answers

Answer:

             x = 0.1    

Step-by-step explanation:

[tex]100x^2-20x+1=0\\\\(10x)^2-2\cdot10x\cdot1+1^2=0\\\\(10x-1)^2=0\\\\10x-1=0\\\\10x=1\\\\x=0.1[/tex]

WILL MARK BRAINLIEST!!! PLZ HELP!!! Which graph best represents the function f(x) = (x + 1)(x − 1)(x − 4)? I think it's D, but im not sure

Answers

Answer:

D

Step-by-step explanation:

Find the x intercepts from the equation and apply them to the graphs. It matches up with D. Your thought is correct

Answer:

[tex]\boxed{\mathrm{D}}[/tex]

Step-by-step explanation:

[tex]y= (x + 1)(x - 1)(x - 4)[/tex]

Let x = 0, find the y-intercept.

[tex]y= (0 + 1)(0 - 1)(0 - 4)[/tex]

[tex]y= ( 1)(- 1)(- 4)[/tex]

[tex]y=4[/tex]

The function crosses the y-axis at 4.

The only graph that shows this is graph D.

Simplify the expression: (− 2/3 pq^4)^2·(−27p^5q)

Answers

Answer:

-12p^7q^9

Step-by-step explanation:

(-2/3Pq^4)^2×(-27P^5q)

= ((-2)^2)/3^2 × P^2 q^4-2 × (-27qp^5)

= ((-2)^2)/3^2 × 27p^7q9

= (((-2)^2 x 27p^7q9)/3^2

= -((4×27p^7q^9)/9)

= -(108p^7q^9)/9

= -12p^7q^9

what is the mean devuation of the following numbers​

Answers

Answer:

hi pls do enter the no.s

Two angles are supplementary (meaning they add up to 180 ° ). The ratio of the relationship of the measure of Angle A to the measure of Angle B is 3:4. What are the measure of both angles?

Answers

Answer:

Angle A= 77.14°

Angle B= 102.86°

Step-by-step explanation:

Supplementary angles are angles that add up to 180°, as stated in the question.

This means that Angle A + Angle B= 180°

The measure of Angle A to Angle B is 3:4

3:4 --------> 3+4 = 7 total parts

Hence, angle A will be 3/7 of the total angle (180°)

angle B will be 4/7 of the total angle (180°)

That is, angle A = 3/7 × 180° = 77.1428°

angle B= 4/7 × 180° = 102.857°

Approximately, angle A = 77.14° while angle B= 102.86°

Please help I am not sure how to solve this problem.

Answers

Answer:

Measure of arc TSU = 201°

Step-by-step explanation:

For the inscribed circle of  triangle XYZ, we have;

∠XZY = 21°

Segment TZ and segment  UZ are tangent to circle R

Therefore, ∠ZUR = ∠ZTR = 90° (angle formed by a tangent)

Length UR = Length TR = Radius of circle R

∴ ΔZTR ≅ ΔZUR Side Angle Side (SAS) rule of Congruency

∴ ∠RZT ≅ ∠RZU, (Congruent Parts of Congruent Triangles are Congruent, CPCTC)

∠XZY = ∠RZT + ∠RZU (Angle summation)

21° = ∠RZT + ∠RZU  = 2×∠RZU (Transitive property)

∠RZU = 21°/2 = 10.5° = ∠RZT

∴ ∠URZ = 180- 90 - 10.5 = 79.5° = ∠TRZ (CPCTC)

arc TU = ∠URT = ∠URZ + ∠TRZ = 79.5 + 79.5 = 159° (angle addition)

∴ Measure of arc TSU = 360° - 159° = 201° (Sum of angles at the center of the circle R)

Measure of arc TSU = 201°.

What’s the y- intercept and x-intercept of y = 3/4x + 3

Answers

Answer:

see below

Step-by-step explanation:

y = 3/4x + 3

To find the y intercept, let x =0 and solve for y

y = 0+3

The y intercept is 3

To find the x intercept, let y =0 and solve for y

0 = 3/4x+3

-3 = 3/4x

-3 *4/3 = 3/4x*4/3

-4 =x

The x intercept is -4

━━━━━━━☆☆━━━━━━━

▹ Answer

y-intercept = 3

x-intercept = -4

▹ Step-by-Step Explanation

y = mx + b

y = 3/4x + 3

0 = 3/4x + 3

-3 = 3/4x

-3 * 4/3 = 3/4x * 4/3

x = -4

Hope this helps!

CloutAnswers ❁

Brainliest is greatly appreciated!

━━━━━━━☆☆━━━━━━━

1. Between finishing their dinner and going to bed, Zac and Lucy had 4 hours.
These pie charts show how they spent their time.
Video games
12°
Reading
Watching TV
Watching TV
Video games
135º 160°
102° / 60°
186°
30°/45°
Homework
Homework/ Reading



It’s exercise 10 please

Answers

Answer:

Ok, I can see only a) to c)

a) Lucy spent the most time reading.

b) 20 minutes.

c) 22 minutes.

Step-by-step explanation:

Reason for b):

First convert hours to minutes.

1 hour = 60 minutes

4 hours = ?

4 × 60 = 240 minutes.

Homework is 30°

Total in the pie chart is 360° so:

30/360 × 240 mins = 20 mins

Answer is Zac spent 20 minutes to do his homework.

Reason for c):

Watching TV:

Zac: 135°

Lucy: 102°

Zac:

135/360 × 240 minutes = 90 minutes

Lucy:

102/360 × 240 minutes = 68 minutes

To find how many minutes Zac spent watching TV than Lucy:

90 minutes - 68 minutes = 22 minutes.

Do you understand, Kiara 12004?

Problem solving: Janine is 7 years younger than Lucy and 4 years older than
Samantha. The average of their ages is 16. How old is:
a. Janine?
b. Samantha?
c. Lucy?

Answers

Answer:

Janine=12.6(repeating) Samantha=15.6(repeating) Lucy=19.6(repeating)

Step-by-step explanation:

Lets concentrate on one person, Janine.

Janine = Lucy - 7

Janine = Samantha - 3

If the averae of the 3 people's ages is 16, then we should multiple that by three to get 48, the number of their ages combined.

Janine + Lucy + Samantha = 48

The differences between Janine to Lucy and Janine to Samantha combined is 10, so we can subtract that from 48 to get 38, which is 3 times Janines age.

38/3=12.6(repeating)

That is Janine's age. We can use that to find both Lucy's and Samantha's ages respectively by using their equations. Lucy's is 19.6(repeating) and Samantha's is 15.6(repeating). I hope you can give me brainliest, and that this helped!

Stephanie left Riverside, California, driving her motorhome north on Interstate 15 towards Salt Lake City at a speed of 56 miles per hour. Half an hour later, Tina left Riverside in her car on the same route as Stephanie, driving 70 miles per hour. Solve the system {56s=70ts=t+12 for t to find the value of s, the number of hours Stephanie will have driven before Tina catches up to her.

Answers

Answer:

The number of hours Stephanie will have driven before Tina catches up to her is 2.5 hours

Step-by-step explanation:

Given:

56s=70t

s=t+1/2

Solution

56s=70t

s=t+1/2

Substitute s=t+1/2 into 56s=70t

56s=70t

56(t+1/2)=70t

56t+28=70t

28=70t - 56t

28=14t

Divide both sides by 14

28/14=14t/14

2=t

t=2

Recall,

s=t+1/2

s=2+1/2

=4+1/2

s=5/2

Or

s=2.5 hours

Give the excluded values for 6/t+5 + 2/t-5 = 3t-1/t^2-25. Do not solve

A)25
B)-5,5
C)5,25
D)-5,5,25

Please help i don’t understand

Answers

Answer:

B -5, and 5

Step-by-step explanation:

you can't have zero on the bottom

A scientist counts 35 bacteria present in a culture and finds that the number of bacteria triples each hour. The function y = 35 ∙ 3x models the number of bacteria after x hours. Estimate when there will be about 550 bacteria in the culture.

Answers

Answer:

After 5 hours

Step-by-step explanation:

If a scientist counts 35 bacteria present in a culture and finds that the number of bacteria triples each hour and the function y = 35 ∙ 3x models the number of bacteria after x hours, in order to estimate when there will be about 550 bacteria in the culture we will substitute y = 550 into the modeled equation and calculate the value of x as shown;

If y = 35*3x

when y = 550

550 = 35*3x

Dividing both sides by 35;

550/35 = 35*3x/35

3x = 550/35

x = 550/3*35

x = 550/105

x = 5.24

This means that there will be 550 bacteria in the culture after approximately 5 hours

Other Questions
What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren Jerry solved the system of equations. x minus 3 y = 1. 7 x + 2 y = 7. As the first step, he decided to solve for y in the second equation because it had the smallest number as a coefficient. Max told him that there was a more efficient way. What reason can Max give for his statement? The variable x in the first equation has a coefficient of one so there will be fewer steps to the solution. The variable x in the second equation has a coefficient of 7 so it will be easy to divide 7 by 7. The variable y in the second equation has a coefficient of 2 so it will be easy to divide the entire equation by 2. The variable x in the second equation has the largest coefficient. When dividing by 7, the solution will be a smaller number. Probability of landing on even # on a spinner; probability of rolling an odd # on a die The amount of flow through a solenoid valve in an automobile's pollution-control system is an important characteristic. An experiment was carried out to study how flow rate depended on three factors: armature length, spring load, and bobbin depth. Four different levels (low, fair, moderate, and high) of each factor were chosen, and a single observation on flow was made for each combination of levels.A) The resulting data set consisted of how many observations?B) Is this an enumerative or analytic study? Explain. Simplify each expression. 6mn3 -mn2 + 3mn3 +15mn2?? Read the following excerpt. The journalist spent a year researching the foreign government's sanctions. Finally, it was time to synthesize all of the relevant information that he had learned. His editor asked him to write a comprehensive article for the first piece in the series that was sure to win awards, inform the public, and elicit significant change in foreign policy. Using the context, the word "elicit" meansdeclarecausecriticizeend y=tan(x-30) period and amplitude