A scale drawing of a playhouse is shown below. What is the total height of the actual playhouse?

A. 4 ft
B. 6 ft
C. 8 ft
D. 16 ft​

A Scale Drawing Of A Playhouse Is Shown Below. What Is The Total Height Of The Actual Playhouse? A. 4

Answers

Answer 1

Answer:

A

Step-by-step explanation:

Answer 2
It’s actually D because half of an Inch =1ft
So 1/2+1/2=1 Inch and 1 inch =2ft so if you know that then it’s just simple 5•2 which is 10 and 3•2 which is 6 and 10+6=16
But u have to remember for other problems that u need to follow the scale

Related Questions

If you are doing a gift exchange, and everyone has to spend at least 10 dollars but less than 20 dollars, what inequality represents the situation

Answers

Answer:

10≥x<20

Step-by-step explanation:

Imad's family drove 345 miles from Chicago to Cleveland.
They drove at a speed of 50 miles per hour. How many hours did it take Imad's family to drive from Chicago to Cleveland?
A
7.1 hr
B
6.35 hr
6.9 hr
D
7.9 hr

Answers

Answer:

6.9 is the answer

Step-by-step explanation:

345 divided by 55. hope this helps....

Please help I have a D in this class.

Answers

Answer:

the value of x in terms of b is bx=-13

the value of x when b is 3 is x=-1

Slope review

PROBLEM : What is the slope of the line whose equation has the following solutions? Give an exact number.
Solution: x = -2.5 y= 0.5
Solution: x=2 y = 2
The slope is:​

Answers

Answer:

To find slope, we must use the slope formula*.

[tex]m = \frac{2 - 0.5}{2 - (-2.5)} = \frac{1.5}{4.5}[/tex]

The slope is 1.5/4.5.

Select the correct answer.
Which pair of statements correctly compares the two data sets?

А.The difference of the means is 1. This value is less than half of the mean absolute deviation of either data set.

B.The difference of the means is 1. This value is more than half of the mean absolute deviation of either data set.

C. The difference of the means is 1. This value is 1 times the mean absolute deviation of either data set.

D. The difference of the means is 1. This value is 2 times the mean absolute deviation of either data set.

Answers

Answer: B?

Step-by-step explanation:

Answer:

Go for B

Step-by-step explanation:

Idk what to put here :(

Answers

Answer: I can barley see that

Step-by-step explanation:

Answer:

give me brainliest plssss i need it

Step-by-step explanation:

An elementary school has 1,134 seeds. The seeds will be planted in 27 rows.
Each row will have the same number of seeds. How many seeds will be planted
in each row?

Answers

42 plants will be planted in each row
You divide 1,134 by 27 and get 42 as your answer

Answer:

42 seeds

Step-by-step explanation:

You would first divide 1,134 seeds by 27 rows. You would get 42 seeds per row, and that would be your answer.

what is the GCF of 12 and 24

Answers

12
bdjxjdisisjfjfnfkdjjd

Find the 12th term of the geometric ouence 5, 15, 45,...

Answers

Answer:

295,245

Step-by-step explanation:

It is always multiplying by 3.

5, 15, 45, 135, 405, 1215, 3645, 10935, 32805, 98,415, 295245

Answer:

885735

Step-by-step explanation:

is 2.6666666667 a rational number

Answers

Answer:

No.

Step-by-step explanation:

I believe that the number above is irrational, because it repeats.

The person above you is wrong


The decimal is rational

In fact every repeating decimals are rational because you can turn them into fraction

Can you please mark brainleist


6. Frank's Fish Washing Service charges a base fee to wash your fish plus a charge per
minute. The table shows the total cost, c, and the number minutes it took to wash
the fish, m. Which equation represents this situation?
o
y = 3x + 8
of Minutes, m
8
10
12
14
Total Cost (S),
30
36
42
48
y = -x + 8
3
O
y = 3x + 6
O
y =
1
-x+6

Answers

Answer:

C

Step-by-step explanation:

simplify the square root of 4x^6

Answers

Answer:

2x^3

Solution

You simplify to the lowest value possible 4x^6

2x^3

What is the quotient of -3/8 And -1/3?​

Answers

Answer:

Actually, I didn't get your question, is it -3/8÷ -1/3 or -1/3÷ -3/8?

If it is -3/8÷ -1/3, the answer will be 9/8

But if is -1/3÷ -3/8, the answer will be 8/9

Step-by-step explanation:

-3/8÷ -1/3

= -3/8× 3/-1

= -9/-8

= 9/8

If your question is -1/3÷ -3/8, the answer is 8/9 in the same way.

please answer this and don't do it for the points

Answers

11/30 - 6/30 - 5/30 = 0
The answer is 0

What is the value of x?
X=

Answers

Step-by-step explanation:

[tex]{:}\longrightarrow[/tex][tex]\sf 13x-12=7x-6 [/tex]

[tex]{:}\longrightarrow[/tex][tex]\sf 13x-7x=-6+12 [/tex]

[tex]{:}\longrightarrow[/tex][tex]\sf 6x=6 [/tex]

[tex]{:}\longrightarrow[/tex][tex]\sf x={\dfrac{6}{6}}[/tex]

[tex]{:}\longrightarrow[/tex][tex]\sf x=1 [/tex]

Circle A has a diameter of approximately 20 inches and an area of 314 in2 (approximately 300 in2) Circle B has a diameter of approximately 60 inches and an area of 2826 in2 (approximately 2700 in2) Circle C has a diameter of approximately 40 inches. Find the area of Circle C and explain or show your reasoning.

Answers

Answer:

1256.8in^2

Step-by-step explanation:

Step one:

Given data

Circle A

diamteter= 20 in

Area= 314 in^2 approx. 300in^2

Circle B

diamteter= 60 in

Area= 2826in^2 approx. 2700in^2

Step two:

Circle C

diamteter= 40 in

radius= 20 in

The expression for A is given as

A=πr^2

A=3.142*20^2

A=3.142*400

A=1256.8

The area of circle C is 1256.8in^2

The perimeter of a triangle is 59 cm. The first side is 7 cm shorter than the second side. The third side is 4 cm less than twice the length of the first side. Find length of each side

Answers

Given:

The perimeter of a triangle is 59 cm.

The first side is 7 cm shorter than the second side.

The third side is 4 cm less than twice the length of the first side.

To find:

The length of each side.

Solution:

Let x be the second side.

Then, according to the question,

First side = x-7

Third side = 2(x-7)-4

Perimeter of a triangle is the sum of all of its sides.

[tex](x-7)+x+(2(x-7)-4)=59[/tex]

[tex]x-7+x+2x-14-4=59[/tex]

[tex]4x-25=59[/tex]

Add 25 on both sides.

[tex]4x=59+25[/tex]

[tex]4x=84[/tex]

Divide both sides by 4.

[tex]x=21[/tex]

Now,

First sides =21 - 7=14 cm

Second side = 21 cm

Third side = 2(14)-4 = 24 cm

Therefore, the three sides of triangle are 14 cm, 21 cm and 24 cm respectively.

#8 linear inequality in two variables is shown below. -4y <-12. Which
graph would represent the solution set of linear inequality? (SOLVE FOR
Y!)
Can someone help explain it!!!

Answers

Answer:

J

Step-by-step explanation:

Step 1: solve for y

Step 2: graph y, use dashed line

Step 3: Shade in solutions, here y>3 so everything bigger then 3 is a solution.

Write the sentence as an inequality.
A number x is greater than 3
The inequality is

Answers

Answer:

X > 3

Step-by-step explanation:

The sentence as an inequality will be x > 3.

It is given that a number x is greater than 3.

We have to represent the sentence as an inequality.

What do you mean by inequalities ?

Inequalities are the expressions in which both sides are not equal and the equal sign in between is replaced by less than , greater than, etc.

As per the question ;

A number x is greater than 3.

So ,

Number is x.

and

It is greater than 3

i.e.,

we need to use a sign of greater than to represent the inequality i.e., > sign.

So ,

The sentence as an inequality can be written as ;

x > 3.

Thus , the sentence as an inequality will be x > 3.

To learn more about inequalities click here ;

https://brainly.com/question/27990392

#SPJ2

A store charges 5.5 % sales tax on all items. If an item costs d dollars before tax, which expression represents the total cost of the item, in dollars and cents, after tax?

Answers

Answer: d + 0.055d or 1.055d

Step-by-step explanation:

Cost of item = d

Sales tax percent = 5.5%

Total cost = Cost of item + Sales tax

= d + (5.5% × d)

= d + (5.5/100 × d)

= d + (0.055 × d)

= d + 0.055d

= 1.055d

Therefore, the expression that represents the total cost of the item, in dollars and cents, after tax will be:

d + 0.055d or 1.055d.

A doctor sees 6 patients in 11⁄2 hours. How many patients does the doctor see per hour?

Answers

Answer:

1.0909090909

Step-by-step explanation:

6÷5.5 is 1.0909090909

round to 1 ig

Answer:

4 patients per hour.

Step-by-step explanation:

1 1/2 hour = 90 minutes

90min/6p= 15min per patient

60min/15min= 4

Solve 5.4p+13.1=−2.6p+3.5 . Check your solution.



p= __

Answers

5.4p +13.1 = −2.6p+3.5 .

5.4p + 2.6p = 3.5 -13.1

8.0p = -9.6

p = -9.6 / 8

p = -1.2

2 pts
Question 3
Select all parts from the expression above that represents a constant term.
-4.9
-4.9t?
1.8
22
22t

Which ones are constant terms pls help

Answers

Constant terms are the terms in the expression that only contain numbers. No variable next to it.



So the constant terms here are: -4.9, 1.8, and 22.



Mark as Brainliest if it helped! :)

Give 3 examples of integers which are greater than −2

Answers

Answer: -1 would be greater than negative two, along with 20, 1000.

-2 is a negative number, so any number that is -1 or higher is greater than -2

Answer:

1,2,3

Step-by-step explanation:

Can someone please tell me if the following relations are functions please?

Answers

yes the first one is a function. The second one with the arrows is not.

Please help !!

What is the general equation to the √x?

Answers

x^1/2 or x to the 1/2 power

RootIndex 3 StartRoot StartFraction x cubed Over c y Superscript 4 Baseline EndFraction EndRoot = StartFraction x Over 4 y (RootIndex 3 StartRoot y EndRoot) EndFraction

Answers

Answer:

C. c = 64

Step-by-step explanation:

The question is incomplete. Here is the complete question.

What value of c makes the equation true? Assume x greater-than 0 and y greater-than 0

RootIndex 3 StartRoot StartFraction x cubed Over c y Superscript 4 Baseline EndFraction EndRoot = StartFraction x Over 4 y (RootIndex 3 StartRoot y EndRoot) EndFraction

c = 12

c = 16

c = 64

c = 81

Given the function;

[tex]\sqrt[3]{\dfrac{x^3}{cy^4} } = \dfrac{x}{4y\sqrt[3]{y} }[/tex]

We are to find the value of c from the expression.

Step 1: Take the cube of both sides;

[tex](\sqrt[3]{\dfrac{x^3}{cy^4} } )^3= (\dfrac{x}{4y\sqrt[3]{y} })^3\\\dfrac{x^3}{cy^4} = \dfrac{x^3}{(4y)^3(\sqrt[3]{y} )^3}\\\dfrac{x^3}{cy^4} = \dfrac{x^3}{(64y^3)(y)}\\\\\dfrac{x^3}{cy^4} = \dfrac{x^3}{64y^4}\\[/tex]

Step 2: compare the denominator of both sides of the equation;

[tex]\dfrac{x^3}{cy^4} = \dfrac{x^3}{64y^4}\\\\On \ comparing;\\\\cy^4 = 64y^4\\[/tex]

Step 3: Divide both sides by y₄

[tex]\dfrac{cy^4}{y^4} = \dfrac{64y^4}{y^4}\\c = 64\\[/tex]

Hence the value of c is 64. Option C is correct

Answer:

C is the anwser

Step-by-step explanation:

my bf told me to pick c, so therfore it is the right anwser. lol no but fr i did get it right on edge

One root of f(x)=x^3-9x^2+26x-24 is x = 2. What are all the roots of the function? Use the Remainder Theorem.

Answers

Answer:

The roots of the of the function are 2,3 and 4.

Step-by-step explanation:

The given function is

f(x) = x³ - 9x² + 26x - 24

It is given that x=2 is a root of the function. So (x-2) is a factor of f(x).

According to the remainder theorem if a function is divided by (x-c), then the remainder is equal to f(c). If f(c) is equal to 0, therefore c is the root of the function.

Use synthetic method to divide f(x) by (x-2).

f(x) = (x - 2) (x² - 7x + 12)

f(x)= (x - 2) (x² - 4x - 3x + 12)

f(x)= (x - 2) (x(x - 4) - 3(x - 4))

f(x)= (x - 2) (x - 4) (x - 3)

To find the roots equation the function equate the function equal to 0.

0 = (x - 2) (x - 4) (x - 3)

Equate each factor equal to 0.

x = 2,3,4

Therefore the roots of the function are 2,3 and 4.

(btw this is someone else's answer i found since i got a little confused myself heh)

Answer:

The roots of the of the function are 2,3 and 4.

Step-by-step explanation:

\The roots of the of the function are 2,3 and 4.

what are the y-intercept and the slope of the line represented in the graph? (i will give most brainly to whoever answers)

Answers

Answer:

Y is 4 and slope is 2

Step-by-step explanation:

the red line hits 4 and the sope is the other number that the red line hits which is 2

Aden spent $10 on a mug and then sold it, making 20% profit, how much did he sell the mug for

Answers

Answer: $2

Step-by-step explanation: 20 percent of 10 is 2

Hope I did this right

The selling cost of the mug is the amount of $12.

What is the percentage?

The percentage is defined as a ratio expressed as a fraction of 100.

For example, If Misha obtained a score of 57% on her exam, that corresponds to 67 out of 100.

We have been given that Aden spent $10 on a mug and then sold it, making a 20% profit.

The original cost of the mug is $10.

The selling cost of the mug = original cost + 20% of the original cost

The selling cost of the mug = $10 + 20% of $10

The selling cost of the mug = 10 + (20/100)10

The selling cost of the mug = 10 + 0.20 × 10

The selling cost of the mug = 10 + 2

The selling cost of the mug = $12

Therefore, the selling cost of the mug is the amount of $12.

Learn more about the percentages here:

brainly.com/question/24159063

#SPJ2

Other Questions
I love you. You are worth it. What does this quote mean? Thanks! Ayala is making salad dressing. She mixes oil andvinegar in a blender until a smooth consistency isformed. Explain whether this is a heterogeneous or ahomogeneous mixture and why. Help?Jessica must determine how many packages of cookies and cupcakes to buy for her family reunion. Jessica's mother has asked her to buy the same number of each type of item but no more than 100 of each. At the bakery, Jessica finds that cookies are sold in packages of 12 and cupcakes are sold in packages of 9.Use the drop-down menus to select the answers that make each statement true.The greatest number of packages that Jessica can buy is _ packages of cookies and _ packages of cupcakes. explain what happens when particles collide When a story is told from the _____, the narrator has full knowledge of all the characters. omniscient third-person point of view reliable first-person point of view unreliable first-person point of view limited third-person point of view The product of the ages of two adults is 572. Find their ages. Guys, I need help ASAP!! The standard deviation of the following data set is 0.31. 95% of the data would fall in which range?4.3, 5.1, 3.9, 4.5, 4.4, 4.9, 5.0, 4.7, 4.1, 4.6, 4.4, 4.3, 4.8, 4.4, 4.2, 4.5, 4.4Pr (3.88 X 5.12)Pr (2.67 X 5.33)Pr (4.19 X 4.81)Pr (3.57 X 5.43) ATG AATTCTCAATTACCTTACTTAA GAGTTAATGGAHow many pieces of DNA would result from this cut a student performed an experiment, using a cocktail peanut, before it was burned the peanut half weighed .353 g. After burning the residue weighed .016 g. The energy released by the conjunction increased the temperature of 200. mL of water in the calorimeter by 7.2 degrees Celsius. Calculate the mass of peanut consumed in the combustion. twice the sum of k and 9 is 4 The product of a number and -5 is at least 35. Write as an inequality. who killed the district judge during the revolutionary movementanswer in one sentence Quick question for you all People who complain that video games involve too much sitting are probably old. They probably dont know very much about gaming, either. They dont realize that people can play virtual sports, such as tennis, on video games. There are video games for dancing, too. If people bothered to learn about the different kinds of video games, they would see how wrong they are. This students sample paragraph addresses the counterclaim. Critique this paragraph by answering the questions.What is the counterclaim?Video games are too violent.Video games make people inactive.Video games are different today.What evidence weakens the counterclaim?People who complain are old.Sitting too much is bad for people.There are video games for sports and dancing.What is the tone of the rebuttal?respectfulrudehumorous Mention the type of seeds that undergo hypogeal germination.What do we call the process of permanently stopping babies from breast feeding?plzz help it is due today 2) look closely at article XLVII. Rephrase it in your own words. How do you think this impacted the unity among slaves during the revolution?Please I need help! Use the interactive tool to graph the line given the following information: coordinates (1,3) slope of 2Based on your investigation, what is the value of b for the point (0,b)? what is carbogen and it's uses Please help!!!! ASAP!!! Thank you!!!