3)m I really need help

3)mI Really Need Help

Answers

Answer 1
Answer:  angle ULM = 120 degrees.

====================================================

Explanation:

We'll use the angle addition postulate. This is basically the idea where we can break any angle into smaller parts, or go in reverse to build up larger angles based on smaller pieces.

In this case, we can see that the smaller angles KLU and ULM combine to form the largest angle KLM. Think of it like puzzle pieces.

Let x be the measure of angle ULM

We can say the following

(angle KLU) + (angle ULM) = angle KLM

(36) + (x) = 156

36 + x = 156

To solve for x, we subtract 36 from both sides

36+x-36 = 156-36

x = 120

Angle ULM is 120 degrees.

-------------------

As a check,

(angle KLU) + (angle ULM) = 36 + 120 = 156

which matches with angle KLM, so the answer is confirmed.

Answer 2
ULM = KLM - KLU

ULM = 156 - 36

ULM = 120 degrees



Related Questions

Which of the following numbers is not a prime number?
A) 13
B) 17
C) 18
D) 19
E) 23

Answers

C) 18 is not a prime number
1, 2, 3, 6 ,9, 18
Are all factors of 18, making it not prime
18 is not a prime number

Grace drew a triangle with sides of equal length. Its measured with sides of 3 cm. What is the perimeter of the triangle?

Answers

Answer:

9 cm explained to

Step-by-step explanation:

explained that

Of the last 18 trains to arrive at Kensington Station, 12 were on time. What is the experimental probability that the next train to arrive will be on time?

Answers

Answer:

6 were late taht is a step to help you

Step-by-step explanation:

What is the distance between (-3,-5) and (-3, 2)?

Answers

Answer: 7 units

Step-by-step explanation:

Just plot the numbers, then count the distance between them

Answer this question and I will give you brainliest and help on anything

Answers

Answer:

The answer is 27

Step-by-step explanation:

You count how many lines it takes up and add them together


1) The width of a rectangle is 6 meters less than its length. The area is 315 square meters. Find the length of the
rectangle

Answers

Answer:21

Step-by-step explanation:

x=length

x(x-6)=315

x^2-6x=315

x^2-6x-315=0

(x-21)(x+15)

x=21, x=-15

x cannot be negative so the only answer is 21

A square patio has an area of 182 square feet. How long is each side of the patio to the nearest tenth?

Answers

Answer:

13.5 feet

Step-by-step explanation:

Square root of 182 = 13.49

the answer is 13.5 feet

Simplify: (4/3q)^4. You may assume that any variables are nonzero.

Answers

Answer:

[tex]\frac{256}{81q^{4} }[/tex]

Step-by-step explanation:

What is the greatest possible error if Irina measured the weight of her dog as 13 pounds?

Answers

Answer:

0.5

Step-by-step explanation:

Given that:

Irina measured the weight of her dog to be 13 pounds.

The greatest possible error that could have to occur will be the maximum error.

Let assume that the 13th value obtained was rounded between the range of 12.5 → 13.49 to 13 pounds

Then;

The greatest possible error that could have to occur = 13.0 - 12.5 pounds

The greatest possible error that could have to occur = 0.5 pounds

Answer:

0.5

Step-by-step explanation:

EDGE 2020 Unit Test

find the sum of the series -10-5-0+......+75​

Answers

Okay so the sum is basically higher numbers example.
The explanation

Each week, Mrs.Mack buys exactly 3 5/8 pounds of cheese for her mac-and-cheese recipe. She chooses from these kinds of cheese. Mrs.Mack buys as many packages as she needs— up to three packages of any kind. What packages of cheese (and how many of each kind) does Mrs.Mack buy? 7/8pounds of american cheese. 0.5 pounds of cheddar cheese. 0.2 pounds of swiss cheese. HELP PLEASE

Answers

9514 1404 393

Answer:

3 packages of American (7/8 lb)2 packages of cheddar (1/2 lb)

Step-by-step explanation:

The amount of cheese Mrs Mack needs is an odd number of eighths of a pound. So, she must buy an odd number of the 7/8 pound packages.

If she were to buy any 1/5 pound packages, she would have to buy a multiple of 5 of them so as to have an integral number of eighths. The only suitable multiple is 0.

If Mrs Mack buys 1 of the 7/8 pound packages, she cannot make up the difference with half-pound packages. She must buy 3 of the 7/8 pound packages, for a total of 2 5/8 pounds of American cheese. The remaining pound can be bought as 2 of the 1/2 pound packages.

To buy 3 5/8 pounds, Mrs Mack must purchase ...

  3 packages of American cheese (7/8 lb each)

  2 packages of Cheddar cheese (1/2 lb each)

If f(x)= -3x+4 and g(x)=2, solve for the value of x for which f(x)=g(x) is true

Answers

Answer:

If i did this right the answer would be f(2)=g(2)

both numbers are 2 and the numbers are (x) so x=2

Step-by-step explanation:

Hope this helps Kas <33

I need help with this please

Answers

What is the question
There was no question so I don’t know what to answer please post it again and I’ll see if I can solve it:)

These two polygons are similar
y = [?]

Answers

Answer:

w = 9

x = 12

y = 5

z = 3

Step-by-step explanation:

The corresponding sides of similar polygons are proportional.

Therefore:

[tex] \frac{w}{3} = \frac{x}{4} = \frac{15}{y} = \frac{9}{z} = \frac{6}{2} [/tex]

Solve for each variable as follows:

✔️[tex] \frac{w}{3} = \frac{6}{2} [/tex]

Multiply both sides by 3

[tex] w = \frac{6}{2} \times 3 [/tex]

[tex] w = 3 \times 3 [/tex]

[tex] w = 9 [/tex]

✔️[tex] \frac{x}{4} = \frac{6}{2} [/tex]

Multiply both sides by 4

[tex] x = \frac{6}{2} \times 4 [/tex]

[tex] x = 3 \times 4 [/tex]

[tex] x = 12 [/tex]

✔️[tex] \frac{15}{y} = \frac{6}{2} [/tex]

Cross multiply

[tex] y \times 6 = 2 \times 15 [/tex]

[tex] 6y = 30 [/tex]

Divide both sides by 6

[tex] y = 5 [/tex]

✔️[tex] \frac{9}{z} = \frac{6}{2} [/tex]

Cross multiply

[tex] z \times 6 = 2 \times 9 [/tex]

[tex] 6z = 18 [/tex]

Divide both sides by 6

[tex] z = 3 [/tex]

Evaluate the following expression. Express your answer in simplest form.
3
16
+
5
18
1
2
5
16
10
32

Answers

Answer:

518125161348

Step-by-step explanation:

                316

518125161032

-------------------------

518125161348

what fraction is equivalent to 0.56​

Answers

Answer:56/100

Step-by-step explanation:

The fraction equivalent to decimal number 0.56 is, 14/25

What is a fraction?

Fraction is a mathematical term, which represents the portion or sub-parts of the whole thing. Basically, It has two parts: numerator and denominator.

Numerator is a number which lies on the top side, it indicates the number of equal parts taken and denominator is on the bottom side, it indicates the equal parts of the whole number.

Given that,

The decimal number 0.56

The equivalent fraction number = ?

For converting it into fraction,

We have to multiply and divide given number by 100

Now,

⇒  0.56 x(100/100)

⇒  56/100

Further, it can be solved

⇒  28/50

⇒   14/25

Thus, the equivalent fraction is 14/25

To know more about Fraction check:

https://brainly.com/question/8482939

#SPJ1

what is 206 divided :) 6

Answers

Answer:

if you mean 206 divided by 6 than the answer will 34.3 (rounded)

Step-by-step explanation:

I used a calculator

Jordan was asked to convert 345,000,000 to scientific notation. His response was 34.5 x 10^7. His teacher told him he was incorrect. Explain Jordan’s mistake and determine the correct answer

Answers

Answer:

345,000,000 =3.45 x 10^8

Step-by-step explanation:

To convert a number to scientific notation, place or move the decimal point of a number until the coefficient of the number is greater than 1 and less than 10. This is Jordan mistake, 34.5 is greater than 10. Which is incorrect!

explanation:

you have 345,000,000

Keep moving the dot till you have 3.45

Then count how many spaces you've moved

To get to 3.45, it took you 8 moves so you would have 3.45*10^8 as your answer

I have $10 my mom gave me $30 my dad gave me $30 my aunt and uncle gave me $100 but I had another $10 so how much do I have

Answers

Answer:

$180

Step-by-step explanation:

10+30+30+100+10=180

You have 180


The reason:if you add 10+30=40 then 30+10=40 then 40+40=80 last 100+80=180

ANOTHER QUESTION PLEASE HELP

Answers

the answer is 4 your welcome

Answer:

c) 4

Step-by-step explanation:

Area of a square is its length times its length, or length²

Square root of 16 is 4

This is very urgent please tell me if the one that is highlighted all blue is correct or not left or right question,which is correct?

Answers

Answer:

right option

Step-by-step explanation:

RIIIIIGGGGGGGGGGGGGHHHHHTTTTT ONE

What is the value of r2s for r=10 and ​s=2?

Answers

Hey there!

10(2)(2) 10(2) = 2020(2) = 40Thus, your answer is: 40

Good luck on your assignment and enjoy your day!

~LoveYourselfFirst

help please 20 points to who answers not 10 points 20

Answers

Answer:

b c and a

Step-by-step explanation:

Answer:

A, B, C

Step-by-step explanation:

I need serious help please!

Equation of a line: given that m equals 5 and P(2,3), find the y-intercept (b), and write the equation of the line in slope intercept form

Equation of a line: given that m equals -2 and P(-4,5), find the y-intercept (b), and right equation of the line and slope intercept form

Giving P(3, -5) and Q(6,3). Find the slope of the line passing through the two points

Answers

Answer:

1. y-intercept = -7

equation: y = 5x - 7

2. y-intercept = -3

equation: y = -2x - 3

3. slope = [tex]\frac{8}{3}[/tex]

Step-by-step explanation:

slope-intercept form: y = mx + b

slope formula: [tex]\frac{y2 - y1}{x2 - x1}[/tex]

To write an equation in slope-intercept form, you need to know the slope(m) and the y-intercept(b).

1. Given: m = 5, P(2, 3). To find the y-intercept, input the given values of m and the point into the equation format and solve for b:

y = mx + b

3 = 5(2) + b

3 = 10 + b

-7 = b

The y-intercept is -7.

Now that we know the slope and the y-intercept, we can write the equation:

y = 5x - 7

2. Given: m = -2, P(-4, 5). To find the y-intercept, input the given values of m and the point into the equation and solve for b:

y = mx + b

5 = -2(-4) + b

5 = 8 + b

-3 = b

The y-intercept is -3.

Now that we know the slope and the y-intercept, we can write the equation:

y = -2x - 3

3. Given: P(3, -5), Q(6, 3). To find the slope, input the given points into the slope formula:

(3, -5) = (x1, y1)

(6, 3) = (x2, y2)

[tex]\frac{y2-y1}{x2-x1}[/tex]

[tex]\frac{3-(-5)}{6-3}[/tex]

Simplify:

3 - (-5) = 3 + 5 = 8

6 - 3 = 3

[tex]\frac{8}{3}[/tex]

The slope of the line passing through points P and Q is [tex]\frac{8}{3}[/tex].

I hope this helps. :)

An $800 couch is marked up 20%. (increase) What is the new price of the couch? ​

Answers

Answer:

The new price of the couch is $960

Step-by-step explanation:

How many yards long is a piece of fabric witha width of 5/8 yrd nd a area of 2 3/4 square yards?

Answers

Answer:

D. [tex] 4\frac{2}{5} [/tex]

Step-by-step explanation:

Area of fabrics = 2¾ square yards

Width of fabrics = ⅝ yard

Length of fabrics = x

Area = length * width

Therefore:

2¾ = ⅝*x

Change the mixed fraction to improper fraction

[tex] \frac{11}{4} = \frac{5x}{8} [/tex]

Cross multiply

[tex] 4*5x = 11*8 [/tex]

[tex] 20x = 88 [/tex]

Divide both sides by 20

[tex] \frac{20x}{20} = \frac{88}{20} [/tex]

[tex] x = \frac{22}{5} [/tex]

[tex] x = 4\frac{2}{5} [/tex]

[tex] length = 4\frac{2}{5} [/tex]

Which of the following is the mean of the sampling distribution

Answers

I have no idea srry i need points

Translate to algebra:

Tom has t dollars. He buys 5 packets of gum worth d dollars each. How much money does he have left?

Answers

Answer: t - 5d

Step-by-step explanation: Since you are buying 5 and they cost d dollars you would multiply 5 by d. Then since you have t dollars as a total you subtract 5d from t so you get t -5d.

Harry earns$12 20 per hour Monday to Friday if he works on a Sunday he owns 1.75 times hourly rate how much will Harry earn if he works for 8 hours on a Sunday

Answers

Answer:

he will make 170.80 that day

Step-by-step explanation:

12.20*1.75*8

Answer:

good question................

please help and I will mark big brain ​

Answers

81, an=-12+((32)-1)3

32-1=31 times 3=93-12=81
Other Questions
Open Response 2 part A: Plant cells and fungal cells have many of thesame types of organelles. Structures X and Y are found in both plant cellsand fungal cells. Structure Z is found in plant cells, but not in fungal cells. A- What is party?XZ HELP PLEASE PLEASE PLEASE!!The function f(x) = 4x 8 is reflected across the y-axis, resulting in a new function, g(x). Write the EQUATION of g(x). Please show how you got it!!! are the triangles congruent? if they are, state how they are congruent. Plz help!In order for the parallelogram tobe a rectangle, x = [? ]13x+34910x+10 How will you display the contribution in your museum Plz plz plz plz plz plz helppppp As a client becomes more fully functioning during the course of several psychotherapy sessions,we would expect the correlation between his or her real and ideal selves to:________.A) decrease.B) stay the same.C) increase.D) do any of these, for the correlation is unrelated to progress in therapy. What is the slope-intercept equation of the line (easy?) Brainliest if right What type of angleseve these?Linear pairAcuteComplementaryOther: Read this passage about seals and sea lions and then answer the question that follows:From a distance, they both look like seals, but once you get up close you can actually see the difference. Seals and sea lions are both fish-loving mammals. Moreover, handy flippers propel them both through the water. But while seals have a tiny opening on the side of their heads, sea lions have actual earflaps. Furthermore, sea lions use their back flippers like feet to scoot along the beach. On the other hand, seals must wriggle and roll to get ahead. On the whole, when you visit a zoo or theme park, it's the honking, barking, funny sea lion you're likely to find playing to the crowds for fishy treats, earflaps and all.In the passage about seals and sea lions, which transition is used to show a contrast? (5 points) aBut bFurthermore cOn the whole dMoreover GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were Read the poem "Bacchus's Regret" by Hunter Doyle and answer the question. [1] King Midas returned my beloved teacher to me, so I rewarded him with a wishwhatever he wanted would be. Midas cried, "Give my fingers a golden touch! Then, I shall have a gilded kingdom and such." [5] I tried to make him see the err of his choice, but he would not heed the caution in my voice. I pleaded with Midas, "Be careful what you choose, for you're only thinking of what you'll gainnot what you'll lose." [9] His thirst for wealth became no match for his appetite; after all, a gold apple is not something one can bite. His daughter wept for her poor starving dad, so he wiped her tears and told her not to be sad. [13] Into a golden statue Midas's daughter became, and he and his greedy wish were ultimately to blame. Yet, maybe if I had put up more of a fight and a fret, then I wouldn't have to live with all this regret. Select the line that best supports the theme greed can prompt bad decisions. Where did the second world war happen mostly? List the places where it happened from most to least. WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! Compare using or = 5 3/4 _ 6 1/4 Reread the paragraph that starts on page 2 and continues on page 3. Click the underline phrases that shows the personification to lead up to the claim that the situation in the colonies is unique. Help Pleasees! Persuasive SpeechIntroductionA. Imagine going out to eat at a restaurant, and you read entrees like "fried human legs" and "human baby parmesan."B. I believe the world would be a happier, healthier, more humane place if everyone were vegetarian -- you should become one!C. Today I am going to enlighten you all about the animal cruelty involved with food processing that goes on behind closed doors, and the healthier lifestyle of being vegetarian.[First let me tell you a little bit about what else your are eating when you choose to eat meat.]BodyA. Every year billions of animals are raised and slaughtered for human consumption. In todays factory farms animals are confined to extremely small spaces so farmers can concentrate on maximizing production.1. This over crowding breeds disease, so the animals are fed antibiotics and sprayed with pesticides.2. The animals are also fed growth hormones.3. So, the chemicals, antibiotics and hormones are passed on to the consumers.4. USDA fact sheet, bacterial contamination of animal products often causes illness and death. Salmonella poisoning can be fatal.5. Time Magazine, bad chicken is responsible for at least 1,000 American deaths each year.[Now, here are some more disturbing facts you should know about meat production.]B. According to the Animal Protection Institute, in the U.S. alone, every year 41.8million beef cattle, 115 million pigs, and 8.785 billion chickens are slaughtered for human consumption. The animals endure much more.1. Beef cattle called "downers" are prodded or dragged to the slaughterhouse, or left without food or water to die.2. Pigs are stunned, hung upside down before their throats are cut and bled to death. If missed, they go to the scalding tank where they may be boiled alive.3. Crowed, chickens peck each other to death. Instead of providing space farmers "debeak" them by cutting off their upper beak with a hot blade.4. I would like to show you some photos taken inside a slaughterhouse.[If animal cruelty is not enough to change your mind, then maybe your own health concerns will make a difference.]C. Studies show meat-eaters are twice as likely to die from heat disease, and 60% more likely to die from cancer than vegetarians.1. Meat consumption has been linked to many diseases, osteoporosis, diabetes, kidney disease, hypertension, and obesity.2. Quoted by William Roberts, MD, editor and chief of The American Journal Of Cardiology, "When we kill animals to eat them, they end up killing us because their flesh, which contains cholesterol and saturated fat, was never intended for human beings, who are natural herbivores."ConclusionI hope that I have enlightened you all about the matters of vegetarianism, and I hope you all will make the right moral and health decisions as I have. Quote by Leonardo de Vinci, "I have, from an early age renounced eating meat. The time will come when we will look upon the murder of animals as they now look upon the murder of humans.Review the persuasive speech outline.If this speech was given to an audience full of people who worked for the cattle industry, what would the speaker have to accomplish?a.motivate them to become meat eatersb.change their beliefs about meatc.weaken the audiences attitude towards vegetablesd.strengthen the audiences attitude towards meat what was the reaction to the proclamation of 1763 by colonists? About 1/5 of all adults in the United States have type O blood. If four randomly selected adults donate blood, find the probability of each of the following events. a. All four are type O. b. None of them is type O. c. Two out of the four are type O . Whats the answer for this question guys??? a copper ore contains 3.00% of copper carbonate, CuCO3, by mass. Which mass of copper would be obtained from 1 tonne of the ore? A 1.91kg B 3.71kg C 15.3kg D 58.4kg