2. The volume of the cylinder correct to 3 significant figures is"
Calculate the volume of the cylinder with a diameter of 10
meters and a height of 8 meters.

2. The Volume Of The Cylinder Correct To 3 Significant Figures Is"Calculate The Volume Of The Cylinder

Answers

Answer 1

Answer:

628 meters²

Option D is the correct option.

Step-by-step explanation:

Given,

Diameter ( D ) = 10 meters

Radius ( r ) = 10 ÷ 2 = 5 meters

Height ( h ) = 8 meters

Volume = ?

Now, let's find the volume of the given cylinder:

[tex]\pi \: {r}^{2} h[/tex]

Plug the values

[tex] = 3.14 \times {5}^{2} \times 8[/tex]

Evaluate the power

[tex] = 3.14 \times 25 \times 8[/tex]

Calculate the products

[tex] = 628 \: {m}^{2} [/tex]

Hope this helps...

Best regards!!


Related Questions

Find the measure of the missing angles in the kite.

Answers

Answer:

1: 90º

2: 25º

Step-by-step explanation:

Hey there!

Well we know that all the middle angles are 90º right angles,

so we can conclude that angle 1 is 90º.

All the angles in a triangle add up to 180 so we can set up the following,

65 + 90 + x = 180

Combine like terms

155 + x = 180

-155 to both sides

x = 25º

So angle 2 is 25º.

Hope this helps :)

Answer:

Below

Step-by-step explanation:

From the kite you easily notice that 1 is a right angle so its mesure is 90°.

2 is inside a triangle. This triangke has two khown angles: a right one and a 65° one.

The sum of a triangle's angles is 180°.

● (2) + 90+65 = 180

● (2) +155 =180

● (2)= 180-155

●(2) = 25°

PLEASEEEEE HELP MEEE

Answers

Answer:

4.16% is the hourly growth rate

Step-by-step explanation:

What we can do here is to first set up an exponential relationship that relates the present number of bacteria, the initial number of bacteria, the growth rate of the bacteria and the number of hours.

What we want to establish here has a resemblance with the compound interest formula in finance.

Let’s see the initial number of bacteria as the amount deposited, the present number of bacteria as the amount after some months, the growth rate as the monthly percentage while the number of hours works like the number of months.

Mathematically, what we have will be;

P = I(1 + r)^h

where P is the present bacteria number, I is the initial, r is the growth rate while h is the number of hours.

Thus, we have the following values from the question;

P = 1530

I = 1,300

r = ?

h = 4

Substituting these values, we have;

1530 = 1300(1 + r)^4

divide both sides by 1,300

1.177 = (1+r)^4

Find the fourth root of both sides

(1.177)^(1/4) = 1+ r

1.0416 = 1 + r

r = 1.0416-1

r = 0.0416

This in percentage is 4.16%

The equations in this system were added to solve for y. What is the value of y? X + 6 y = 10. Minus x + 3 y = negative 15. Equals 9 y = negative 5. Y = Negative StartFraction 9 Over 5 EndFraction y = Negative StartFraction 5 Over 9 EndFraction y = StartFraction 5 Over 9 EndFraction y = StartFraction 9 Over 5 EndFraction

Answers

Answer:

y = StartFraction 5 Over 9 EndFraction

y=5/9

Step-by-step explanation:

Given:

x+6y=20

-x+3y=-15

x+6y=20. (1)

-x+3y=-15 (2)

From (1)

x=20-6y

Substitute x=20-6y into (2)

-x+3y=-15

-(20-6y)+3y = -15

-20+6y+3y = -15

9y=-15+20

9y=5

Divide both sides by 9

9y/9=5/9

y=5/9

y = StartFraction 5 Over 9 EndFraction

Answer:

y=-5/9

Step-by-step explanation:

9y=-5

---------- Divided by 9

9      9  

Y is equal to negative five over 9

Have a good day and stay safe!

Answers:
3x-2y=-12
2x-3y=-12
3x+2y=12
3x+3y=-12

Answers

Answer:

3x + 2y = 12.

Step-by-step explanation:

Two conspicuous points on the graph are at (0, 6), and (4, 0).

That means the slope of the line is (6 - 0) / (0 - 4) = 6 / -4 = -3 / 2.

The intercept of the line is at (0, 6).

This means that the equation of the line is y = -3/2x + 6.

y = -3/2x + 6

Add 3/2x to both sides

3/2x + y = 6

Multiply all terms by 2

3x + 2y = 12

Hope this helps!

a single carton of juice cost $4.20. A special offer pack of 3 cartons cost $9.45. Jace bought a special offer instead of 3 single cartons. Calculate his percent saving

Answers

The 3 pack cost $9.45

3 single cartons would have cost: 3 x 4.20 = $12.60

Difference in cost: 12.60 - 9.45 = $3.15

Percent savings : 3.15/ 9.45 = 0.3333

0.333 x 109 = 33.33%

Round the answer as needed

The floor of a rectangular swimming pool has an area of 350 sq.meters, and every point on the floor is of equal depth. If 4,200
cubic meters of water is poured into the pool, how deep will the water level be?

Answers

Answer: The depth is 12m

Step-by-step explanation:

The area is 350m^2

And the depth in each point of the base is at the same depth D.

Then we have a cuboid.

Now, the volume of a cuboid is equal to:

V= L*W*D

L = lenght, W = width and D = depth.

Such that L*W = area = 350m^2

then we have:

V = D*350m^2

Now we want V = 4200m^3

4200m^3 = D*350m^2

D = (4200/350) m = 12m

The depth is 12m

Which set of ordered pairs does not represent a function?
A{(-8,0),(4,0),(5,-2), (7,-9)}
B{(-6,0), (-4,2), (4,0), (-1,-9)}
C{(6,-9),(-3,6),(-3,-7),(-9, -2)}
D{(5,-6), (0,5), (-4, -8), (1, -8)}​

Answers

Answer:

C

Step-by-step explanation:

In a function, each domain has one range. But a range can have many domains.

Think about it like this:

Patty is eating dinner

Patty is swimming

Both can't happen at the same time.

But:

Patty is eating dinner

Leo is eating dinner

C has two domains of -3, each having different ranges.

Hope that helps, tell me if you need further info. =)

Answer:

C. C{(6,-9),(-3,6),(-3,-7),(-9, -2)}

Step-by-step explanation:

If you see the same x-coordinate used more than once, it is not a function.

Here, you only see this in choice C, where x = -3 for two points. That makes this relation not a function.

If alpha and beta are the angles in the first quadrant tan alpha = 1/7 and sin beta =1/ root 10 then usind the formula sin (A +B) = sin A. CosB + sina. CosB find the value of alpha + 2beta​

Answers

Answer:

[tex]$\arcsin\left(\frac{129\sqrt{2}}{250}\right)\approx 0.8179$[/tex]

Step-by-step explanation:

[tex]\alpha \text{ and } \beta \text{ in Quadrant I}[/tex]

[tex]$\tan(\alpha)=\frac{1}{7} \text{ and } \sin(\beta)=\frac{1}{\sqrt{10}}=\frac{\sqrt{10} }{10} $[/tex]

Using Pythagorean Identities:

[tex]\boxed{\sin^2(\theta)+\cos^2(\theta)=1} \text{ and } \boxed{1+\tan^2(\theta)=\sec^2(\theta)}[/tex]

[tex]$\left(\frac{\sqrt{10} }{10} \right)^2+\cos^2(\beta)=1 \Longrightarrow \cos(\beta)=\sqrt{1-\frac{10}{100}} =\sqrt{\frac{90}{100}}=\frac{3\sqrt{10}}{10}$[/tex]

[tex]\text{Note: } \cos(\beta) \text{ is positive because the angle is in the first qudrant}[/tex]

[tex]$1+\left(\frac{1 }{7} \right)^2=\frac{1}{\cos^2(\alpha)} \Longrightarrow 1+\frac{1}{49}=\frac{1}{\cos^2(\alpha)} \Longrightarrow \frac{50}{49} =\frac{1}{\cos^2(\alpha)} $[/tex]

[tex]$\Longrightarrow \frac{49}{50}=\cos^2(\alpha) \Longrightarrow \cos(\alpha)=\sqrt{\frac{49}{50} } =\frac{7\sqrt{2}}{10}$[/tex]

[tex]\text{Now let's find }\sin(\alpha)[/tex]

[tex]$\sin^2(\alpha)+\left(\frac{7\sqrt{2} }{10}\right)^2=1 \Longrightarrow \sin^2(\alpha) +\frac{49}{50}=1 \Longrightarrow \sin(\alpha)=\sqrt{1-\frac{49}{50}} = \frac{\sqrt{2}}{10}$[/tex]

The sum Identity is:

[tex]\sin(\alpha + \beta)=\sin(\alpha)\cos(\beta)+\sin(\beta)\cos(\alpha)[/tex]

I will just follow what the question asks.

[tex]\text{Find the value of }\alpha+2\beta[/tex]

[tex]\sin(\alpha + 2\beta)=\sin(\alpha)\cos(2\beta)+\sin(2\beta)\cos(\alpha)[/tex]

[tex]\text{I will first calculate }\cos(2\beta)[/tex]

[tex]$\cos(2\beta)=\frac{1-\tan^2(\beta)}{1+\tan^2(\beta)} =\frac{1-(\frac{1}{7})^2 }{1+(\frac{1}{7})^2}=\frac{24}{25}$[/tex]

[tex]\text{Now }\sin(2\beta)[/tex]

[tex]$\sin(2\beta)=2\sin(\beta)\cos(\beta)=2 \cdot \frac{\sqrt{10} }{10}\cdot \frac{3\sqrt{10} }{10} = \frac{3}{5} $[/tex]

Now we can perform the sum identity:

[tex]\sin(\alpha + 2\beta)=\sin(\alpha)\cos(2\beta)+\sin(2\beta)\cos(\alpha)[/tex]

[tex]$\sin(\alpha + 2\beta)=\frac{\sqrt{2}}{10}\cdot \frac{24}{25} +\frac{3}{5} \cdot \frac{7\sqrt{2} }{10} = \frac{129\sqrt{2}}{250}$[/tex]

But we are not done yet! You want

[tex]\alpha + 2\beta[/tex] and not [tex]\sin(\alpha + 2\beta)[/tex]

You actually want the

[tex]$\arcsin\left(\frac{129\sqrt{2}}{250}\right)\approx 0.8179$[/tex]

Answer:

ok bye guy................

Which of the following segments is a radius of 0?

Answers

Answer:

D. RO

Step-by-step explanation:

According to the rational root theorem, which of the following are possible
roots of the polynomial function below?
F(x) = 6x3 - 7x2 + 2x + 8

Answers

Answer:

18- 14+8=3x

4+8=3x

12=3x

12/3=2x/3

x=4

Answer:

2/3, -8, -1/6, 4.

Step-by-step explanation:

Step-by-step explanation:

The rational root theorem states that if the leading coefficient is taken to be an and the constant coefficient is taken to be a0 the possible roots of the equation can be expressed as :

Now, from the given options, the possible choices can be :

A, B, C and E

D can be there because after taking any pair the rational root can't be 3

F can't be possible because an does't have 4 in its factors so denominator cannot be 4.

The average student loan debt is reported to be $25,235. A student belives that the student loan debt is higher in her area. She takes a random sample of 100 college students in her area and determines the mean to be $27,524 and the standard devition to be $6000. Is there sufficient evidence to support the student' claim at a 5% significance level?

Answers

Answer:

We reject the students claim because the P-value is less than the significance level.

Step-by-step explanation:

First of all let's define the hypothesis;

Null hypothesis;H0; μ = 25,235

Alternative hypothesis;Ha; μ > 25,235

Now, let's find the test statistic. Formula is;

t = (x' - μ)/(σ/√n)

We are given;

x' = 27,524

μ = 25,235

σ = 6000

n = 100

Thus;

t = (27524 - 25235)/(6000/√100)

t = 2289/600

t = 3.815

So from online p-value calculator as attached, using t=3.815, DF = 100-1 = 99 and significance level of 0.05, the P-value is gotten as p = 0.000237.

The p-value is less than the significance level of 0.05. Thus,we reject the students claim.

How many weeks are in 784 days?​

Answers

Answer:

112 weeks

Step-by-step explanation:

784/7=112

Answer:

112 weeks............

Hey loves<3!!! Can any of you lovely people help me out plz?

Answers

Answer:

Hey there!

Triangle PQT and RQT are congruent by AAS. AAS means that one side is congruent, and two angles are congruent.

Since these triangles share one side, then the side is congruent.

PR is a straight line, so if angle Q is 90 degrees, then the supplementary angle is also 90 degrees.

Finally, the diagram shows that angles R and P are congruent to each other.

Hope this helps :)

A pole that is 2.5 M tall cast a shadow that is 1.72M lawn dart at the same time a nearby tower cast a shadow that is 50.5 M long how tall is the tower round answer to the nearest meter

Answers

Answer:

The tower is 73.4 m tall

Step-by-step explanation:

The height of the pole = 2.5 m

The shadow cast by the pole = 1.72 m

Shadow cast by tower = 50.5 m

To find the height of the tower, we proceed by finding the angle of elevation, θ, of the light source casting the shadows as follows;

[tex]Tan\theta =\dfrac{Opposite \ side \ to\ angle \ of \ elevation}{Adjacent\ side \ to\ angle \ of \ elevation} = \dfrac{Height \ of \ pole }{Length \ of \ shadow} =\dfrac{2.5 }{1.72}[/tex]

[tex]\theta = tan ^{-1} \left (\dfrac{2.5 }{1.72} \right) = 55.47 ^{\circ}[/tex]

The same tanθ gives;

[tex]Tan\theta = \dfrac{Height \ of \ tower}{Length \ of \ tower \ shadow} =\dfrac{Height \ of \ tower }{50.5} = \dfrac{2.5}{1.72}[/tex]

Which gives;

[tex]{Height \ of \ tower } = {50.5} \times \dfrac{2.5}{1.72} = 73.4 \ m[/tex]

The path of a cannon firing a cannonball can be modeled by the function h(x) = –x2 + 4x + 12, where x is time in seconds and h(x) is the height of the cannonball in feet. At what time does the cannonball reach its maximum height? seconds

Answers

Answer:

after 2 seconds

Step-by-step explanation:

Given

h(x) = - x² + 4x + 12

The ball will reach its maximum at the vertex of the parabola

Find the zeros by letting h(x) = 0, that is

- x² + 4x + 12 = 0 ← multiply through by - 1

x² - 4x - 12 = 0 ← in standard form

(x - 6)(x + 2) = 0 ← in factored form

Equate each factor to zero and solve for x

x - 6 = 0 ⇒ x = 6

x + 2 = 0 ⇒ x = - 2

The x- coordinate of the vertex is at the midpoint of the zeros, thus

[tex]x_{vertex}[/tex] = [tex]\frac{-2+6}{2}[/tex] = [tex]\frac{4}{2}[/tex] = 2

Substitute x = 2 into h(x)

h(2) = - 2² + 4(2) + 12 = - 4 + 8 + 12 = 16

The cannonball reaches its maximum height of 16 ft after 2 seconds

Answer:

2 seconds

Step-by-step explanation:

I just did it just trust me. This isn't reated to the answer but I had spagehtti for lunch

A paper cup is dropped and its landing position is recorded. The cup can land on the side, on the open end, or on the closed end. The results of 20 trials are shown in the table below: Based on the table, which of the following best compares the experimental probability of the cup landing on its open end with the experimental probability of the cup landing on its closed end?
The probabilities are equal.
The probability of landing on the open end is greater.
The probability of landing on the closed end is greater.
No conclusion can be made.

Answers

Answer:

"The probabilities are equal."

Step-by-step explanation:

Since the amount of times the paper cup landed on its open, and closed end is equal, then the answer is "The probabilities are equal."

Answer: the probability’s are equal

Step-by-step explanation:

the area of the quadrilateral whose vertices are (2,1) , (3,5) ,(-3,4) and (-2,-2) is; A) 13 B) 12 C)29 D)25

Answers

Answer:

option D 25 is the right answer

Answer:  D) 25

Step-by-step explanation:

I graphed the coordinates and partitioned it into four triangles and one rectangle. Then I found the area for each partition.

The sum of the partitions is 25.

Can someone give me some help??

Answers

Answer:

OPtion B)

Step-by-step explanation:

Answer: Choice C)

y < (-1/5)x + 1

The boundary line is y = (-1/5)x+1 as it goes through the points shown. The boundary line is dashed or dotted, meaning that points on this boundary line are not in the solution set. So we will not have an "or equal to" as part of the inequality sign. More specifically, the inequality sign is "less than" because we shade below the boundary line. So that's how we end up with y < (-1/5)x+1.

A study of the annual population of toads in a county park shows the population, S(t), can be represented by the function S(t)=152(1.045)t, where the t represents the number of years since the study started. Based on the function, what is the growth rate?

Answers

Answer:

Based on the function, the growth rate is 4.5%

Step-by-step explanation:

In this question, we are given the exponential equation and we are told to deduce the growth rate.

Mathematically, we can rewrite the exponential equation as follows;

S(t) = 152(1.045)^t = 152(1 + 0.045)^t

What we see here is that we have successfully split the 1.045 to 1 + 0.045

Now, that value of 0.045 represents the growth rate.

This growth rate can be properly expressed if we make the fraction given as a percentage.

Thus the issue here is converting 0.045 to percentage

Mathematically, that would be;

0.045 = 4.5/100

This makes is 4.5%

So the growth rate we are looking for is 4.5%

25 POINTS + BRAINLIEST !!!! A fruit bowl contains apples and bananas in the ration 4 : 5. Two apples are removed changing the ratio to 2 : 3. Work out the total number of fruit that remain in the bowl.

Answers

Answer:

Total number of fruits remaining =  25

Step-by-step explanation:

Let the number of

apples = 4x

bananas = 5x

Therefore

4x-2 / 5x = 2 / 3

Solve for x, cross multiply

3(4x-2) = 2(5x)

12x - 6 = 10 x

2x = 6

x = 3

Apples = 4*3 = 12

Bananas = 5*3 = 15

Apples remaining = 12-2 = 10

Total number of fruits remaining = 10+15 = 25

Answer:

[tex]\boxed{25 \ fruits}[/tex]

Step-by-step explanation:

Let apples be 4x and Bananas be 5x

So, the given condition is:

[tex]\frac{4x-2}{5x} = \frac{2}{3}[/tex]

Cross Multiplying

5x*2 = 3(4x-2)

10x = 12x - 6

Adding 6 to both sides

10x+6 = 12x

12x - 10x = 6

2x = 6

x = 3

Now, Fruits remaining in the bowl are:

=> 4x-2 + 5x

=> 12 - 2 + 15

=> 10+15

=> 25

4) John's sister is 8 years less than twice his age. If John is 39, what age is his sister?

Answers

Answer:

Sister is 70

Step-by-step explanation:

John is 39.

8 less than twice his age is

39*2-8 = 70

Answer:

70 years old.

Step-by-step explanation:

Since John's sister is 8 years younger than TWICE his age, we just need to multiply 39*2 which equals 78. Now we just need to subtract 8 which equals 70.

Hope this helps!! <3

Angle measures and segment lengths. Two tangents. PLEASE HELP ASAP! LIKE IN 2 MINS PLZ!!! :)

Answers

Answer:

x=60 degrees

Step-by-step explanation:

Formula for angle at x=1/2(240-120)

x=60

SHOW ME HOW TO SOLVE THIS PLSS>>> The price of a tennis racquet is inversely proportional to its weight. If a 20 oz. racquet cost $30.00, what would a 25 oz. racquet cost?

Answers

Answer:

$24

Step-by-step explanation:

Inversely proportional means that the two variables (price and weight in this case) will always have the same product. Therefore, we can write the following equation:

25 * x = 20 * 30 (where x is the price of a 25 oz. racquet)

25x = 600

x = $24

What is the center of the circle with the equation (x-1)^2 + (y+3)^2= 9? a (1,3) b (-1,3) c (-1,-3) d (1,-3)

Answers

Answer:

The center is ( 1,-3) and the radius is 3

Step-by-step explanation:

The equation of a circle can be written in the form

( x-h)^2 + ( y-k) ^2 = r^2 where ( h,k) is the center and r is the radius

(x-1)^2 + (y+3)^2= 9

(x-1)^2 + (- -3)^2= 3^2

The center is ( 1,-3) and the radius is 3

The value of x in the proportion 1/2:2/3 = 3/4:x is
1
4/9
1779
14
PLEASE HELP

Answers

Answer:

x = 1

Step-by-step explanation:

Given

[tex]\frac{1}{2}[/tex] : [tex]\frac{2}{3}[/tex] = [tex]\frac{3}{4}[/tex] : x

Multiply all parts by 12 to clear the fractions

6 : 8 = 9 : 12x , simplifying

3 : 4 = 3 : 4x

Thus

4x = 4 ( divide both sides by 4 )

x = 1

how to do this question plz ​

Answers

Answer:

Step-by-step explanation:

9-5=4

8*4*10=320

5*10*3=150

320+150=470

470 cm³

What is the equation of the line that passes through (1, 3) and (-2, -3)? y = -2x + 1 y = 2x + 1 y = x - 1 y = -x + 1

Answers

Answer: y = 2x+1

Step-by-step explanation:

It is the only line with (1,3) as a solution.  A slower algebraic way to solve this would be to plug in 1 for x and 3 for y, then, out of the equations in which it works, plug in -2 for x and -3 for y.  The equation that remains true for both points is the answer.

Hope it helps <3

Answer:

[tex]\boxed{y = 2x + 1}[/tex]

Step-by-step explanation:

The line passes through (1, 3).

The solution of the line is the points it crosses.

x = 1

y = 3

Plug x as 1 and y as 3 in the equation.

y = -2x + 1

3 = -2(1) + 1

3 = -2 + 1

3 = -1 False

Plug x as 1 and y as 3 in the equation.

y = 2x + 1

3 = 2(1) + 1

3 = 2 + 1

3 = 3 True

Plug x as 1 and y as 3 in the equation.

y = x - 1

3 = 1 - 1

3 = 0 False

Plug x as 1 and y as 3 in the equation.

y = -x + 1

3 = -(1) + 1

3 = -1 + 1

3 = 0 False

If a and b are rational numbers and 5 +2 root 3/7+4 root3=a-b root 3;then a and b=

Answers

Answer:

           [tex]\bold{a=5\,,\quad b=-4\frac27}[/tex]

Step-by-step explanation:

[tex]5+\frac{2\sqrt3}7+4\sqrt3=5+\frac27\sqrt3+4\sqrt3=5+4\frac27\sqrt3=5-(-4\frac27)\sqrt3[/tex]

How to do this question plz answer ​

Answers

Answer:

126 cm³

Step-by-step explanation:

The volume (V) of the prism is calculated as

V = Al ( A is the cross sectional area and l the length ), thus

V = 21 × 6

   = 126 cm³

What are the coordinates of the image of point B, after the segment has been dilated by a scale factor of 3 with a center of dilation at the origin? On a coordinate plane, line segment A B has points (negative 6, 8) and (negative 3, 3). (–9, 9) (9, –9) (–1, 1) (1, –1)

Answers

Answer: (–9, 9)

Step-by-step explanation:

if the original point (x,y) gets dilated by a scale factor 'k' with a center of dilation at the origin, then

The coordinates of the image point are (kx, ky).

Given: The coordinates of  line segment A B are A(-6,8) and B(-3,3).

then , the coordinates of B after dilation by scale factor of 3 with a center of dilation at the origin,

[tex](-3,3)\to(3(-3),3(3))\\\\\Rightarrow\ (-3,3)\to(-9,9)[/tex]

Hence, the coordinates of the image of point B, after the segment has been dilated by a scale factor of 3 with a center of dilation at the origin = (–9, 9).

Answer:option A.

Step-by-step explanation: because the point B is dialated and that’s where you will find you answer and edge cumulitive exam 2020.

Other Questions
Please answer this correctly without making mistakes What is the slope of the line passing through the points (6,7) and (1,5) An education researcher claims that 58% of college students work year-round. In a random sample of 400 college students, 232 say they work year-round. At alphaequals0.01, is there enough evidence to reject the researcher's claim? Complete parts (a) through (e) below. It is a well-known fact that Dr. Barnes rides a skateboard, sometimes even on campus. Suppose that Dr. Barnes selects a skateboard by first picking one of two skateboard shops at random and selecting a skateboard from that shop at random. The first shop contains two "rad" skateboards and three "gnarly" skateboards, and the second shop contains four "rad" skateboards and one "gnarly" skateboard. What is the probability that Dr. Barnes picked a skateboard from the first shop if he has selected a "gnarly" skateboard? What the answer to the question If a circle has a diameter with endpoints of (-3, 0) and (5, 4) then the equation of the circle is? Ethyl methane sulfonate is a chemical mutagen that modifies bases in DNA. This agent causes C to be mutated to T. What is the outcome if this type of mutation occurs in the bases of codon 5 in the sequence of the following sense strand of DNA? GTCACCGGTCTATACATAAGC A) There would be a change in DNA sequence but no change in the protein sequence due to the redundancy of the genetic code. B) There would be a mis-sense mutation, resulting in the substitution of an Asn for a His residue in the protein. C) There would be a non-sense mutation, resulting in the synthesis of a truncated protein. D) Both B and C are possible outcomes. g A spontaneous process is one in which: A. releases a large amount of heat B. may happen (is possible) C. will rapidly approach equilibrium D. will happen quickly Based on the function F(x) = x^4 - 3x^3+ x^2 +2 and the graph of G(X) below,which of the following statements is true? The goal of a statement of purpose is: 62(1+2) isn't that should be 1 , cause in the calculator it said 9 but the order is the parenthisis/brakets first ?? so it should be like 2 times 3 then 66 which gives 1 . Which of the following pitches is a non-chord tone for the I chord in G major? - G - B - A - D When a negative amount is in the base period and a positive amount is in the analysis period (or vice versa), a meaningful percent change cannot be calculated.A. TrueB. False A cookie recipe requires 3 teaspoons of baking soda for 36 cookies. If the baker would like to make 480 cookies, how much baking soda will be required? a13.33 teaspoons b12 teaspoons c40 teaspoons d108 teaspoons The flesh of infants may be used asgloves and summer boots Swift objects to eating girls as old as 14because they would serve better asbreeders, and because people wouldobject that it is "a little bordering oncruelty"Although there are many suffering"aged, diseased," or injured people,nothing needs to be gone for thembecause they are already dying "as fastas can be reasonably expected"Poor Irish tenants, who have already soldtheir crops and cattle to pay the rent,will now be able to pay by selling theirchildren Jerry solved the system of equations. x minus 3 y = 1. 7 x + 2 y = 7. As the first step, he decided to solve for y in the second equation because it had the smallest number as a coefficient. Max told him that there was a more efficient way. What reason can Max give for his statement? The variable x in the first equation has a coefficient of one so there will be fewer steps to the solution. The variable x in the second equation has a coefficient of 7 so it will be easy to divide 7 by 7. The variable y in the second equation has a coefficient of 2 so it will be easy to divide the entire equation by 2. The variable x in the second equation has the largest coefficient. When dividing by 7, the solution will be a smaller number. Probability of landing on even # on a spinner; probability of rolling an odd # on a die The amount of flow through a solenoid valve in an automobile's pollution-control system is an important characteristic. An experiment was carried out to study how flow rate depended on three factors: armature length, spring load, and bobbin depth. Four different levels (low, fair, moderate, and high) of each factor were chosen, and a single observation on flow was made for each combination of levels.A) The resulting data set consisted of how many observations?B) Is this an enumerative or analytic study? Explain. Simplify each expression. 6mn3 -mn2 + 3mn3 +15mn2?? Read the following excerpt. The journalist spent a year researching the foreign government's sanctions. Finally, it was time to synthesize all of the relevant information that he had learned. His editor asked him to write a comprehensive article for the first piece in the series that was sure to win awards, inform the public, and elicit significant change in foreign policy. Using the context, the word "elicit" meansdeclarecausecriticizeend