2. A chef pours a cup of rice into a pot of boiling water and observes the rice swirling around in the plot. Which of the following explains the cause of this motion?

A. Heat transfer by radiation makes the rice vibrate.

B. The rice is carried along by conduction.

C. The chef stirred the pot before the rice was added.

D. The rice is carried along by convection currents.

Choose one correct answer.''

Answers

Answer 1

Answer:

D

Explanation:

Not A > Radiation comes from the sun

Not B > Conduction involves direct contact with a heat-conducting object (if the rice were to

Not C > Irrelevant to heat transfer

Answer 2
The answer is C
I don’t know if you want an explanation

Related Questions

The difference between a food web and biogeochemical cycle is -
O Food webs only pertain to ecosystems
O Geochemical cycles lose more energy
Geochemical cycles don't lose anything, food webs lose energy
O Food webs lose energy and geochemical cycles lose nutrients

Answers

Answer:

Food webs only pertain to ecosystems.

Explanation:

The primary gases of the atmosphere are blank

Answers

Answer:

Nitrogen and oxygen are by far the most common; dry air is composed of about 78% nitrogen (N2) and about 21% oxygen (O2). Argon, carbon dioxide (CO2), and many other gases are also present in much lower amounts; each makes up less than 1% of the atmosphere's mixture of gases.

HEYYYYYYYYYY PLEASE HELP!!!!!

Answers

Answer:

Velocity

Explanation:

Given the change in positive (direction) over time we are given the velocity formula.

V = Change in direction/Change in time

Since we are given a direction we can rule out speed as well as direction in itself. We can also rule out acceleration because that is the change in Velocity divided by change in time.

Giving brainliest!!!!!!!!! This is the last question on the test so i bumped up the points ;)

Answers

Answer:

D

Explanation:

All living organisms have to have cells

The photos below show three types of muscle tissue. Which type of muscle is
found only in the heart?

A. C
B. A and C
C. A
D. B

Answers

Answer:

C the heart operates on cardiac muscle

Explanation:

what do you mean by Dermatology?​

Answers

Answer:

its basically the treatment of skin contiditions like acne and other stuff

Explanation:

Answer:

Dermatology is the science that is concerned with the diagnosis and treatment of diseases of the skin, hair and nails.

Explanation:

Crowdsourcing was used to solve problems for what science discipline?

Answers

Answer:

A. Science relies on observation, measurement, and experimentation.

Explanation:

ok Np bye!

2. A scientist is investigating the chemical properties of a hydrogen atom (H), which has an
electroegativtiy of 2.1, and a chlorine atom (CI), which has an electronegativity of 3.0.
Suppose these two atoms form a chemical bond resulting in the compound HCI.
Predict whether the compound is held together by an ionic, a polar covalent,
a nonpolar covalent, or a hydrogen bond.
Explain your prediction.
Describe the bond in terms of its electrical charge. (PLEASE HELP I NEED IT BY 11:59 50 POINTS)

Answers

A Nonpolar Covalent, Because A nonpolar covalent bond is a covalent bond in which the bonding electrons are shared equally between the two atoms. ... A nonpolar covalent bond is one in which the distribution of electron density between the two atoms is equal.

Explanation:

I Think :DDD

Which of the following is not an organelle that prokaryotic and eukaryotic cells share?


ribosomes


Golgi apparatus


cytoplasm


cell membrane

Answers

Explanation:

I think it will be ribosome please follow me

Organisms that live near or on the ocean floor are called

Answers

Answer:

Benthos

Explanation:

Animals that live on the sea floor are called benthos. Most of these animals lack a backbone and are called invertebrates. Typical benthic invertebrates include sea anemones, sponges, corals, sea stars, sea urchins, worms, bivalves, crabs, and many more.

Answer:

Organisms that live near or on the ocean floor are called benthos.

hope this helps <3

please help me with this i’ll give brainlist:)

Answers

Answer:

D

Explanation:

Which statement best explains why the atmosphere is considered an open system?
A.
There is no definite boundary separating it from outer space.
B.
Energy and matter can enter and leave.
C.
Its molecules can move freely, without resistance.
D.
It can accept an unlimited amount of energy.

Answers

Answer:

thw anser is A

Explanation:

A student is collecting the gas given off from a frog living in an enclosed tank. The
gas being collected is probably
Oxygen
Nitrogen
Carbon Dioxide

Answers

Answer:

oxygen

Explanation:

Answer: Oxygen is the most likely to be correct (could be carbon dioxide if using a certain time limit but highly doubt it).

Explanation: I say this Bc unless that frog was being tortured inside it’s tank, I doubt it would be carbon dioxide or nitrogen... simply put, carbon dioxide is the air we breathe out, and the tank would have to be completely sealed in order to collect it later on (and the frog wouldn’t survive very long like that either) Nitrogen is just a bad idea ngl, it’s basically the atmosphere we live in but it can be used as a coolant which I doubt the frog would even need so yeah. Hope this helps

What is the difference between the way energy puts limits on life and the way phosphorus does so?

Answers

Phosphorus is reusable energy and in life you cannot reuse energy

Adenosine triphosphate (ATP) production, the creation of sugar and alcoholic esters, and other energy-transfer processes all need phosphorus.

What is the role of phosphorus in energy?

In many enzymatic processes, where inorganic phosphorus regulates the rate of reaction, phosphorus also serves a regulatory purpose in addition to these other tasks.

This holds true for everything from exploration to the development of young children and is determined not by our muscles and lungs but rather by the amount of energy we can obtain from food.

It has a significant impact on how the body utilizes fats and carbs. The production of protein by the body is also necessary for the development, upkeep, and healing of cells and tissues.

Therefore, the way energy puts limits on life and the way phosphorus is different.

Learn more about energy here:

https://brainly.com/question/13818830

#SPJ2

What are
"sungrazers"? Why is this a good, descriptive name to use?

Answers

a comet that passes extremely close to the Sun at perihelion – sometimes within a few thousand kilometres of the Sun's surface. Although small sungrazers can completely evaporate during such a close approach to the Sun, larger sungrazers can survive many perihelion passages. However, the strong evaporation and tidal forces they experience often lead to their fragmentation.

please help me out with this newsela question

Answers

Answer: the answer is a

Explanation:because it is stating that you have to see if there is anything involving chemical substances.

que Graphing and Analyzing Data (Cricket Chirps) In order to determine if cricket chirps are influenced by temperature, scientists recorded the chirps at different temperatures over a month-long period. Day Temperature (Fahrenheit) Average Number Chirps (per 15 sec) 5/05 54 15 5/09 60 21 5/11 58 19 5/20 68 29 5/22 64 25 5/27 72 33 6/01 80 44. 6/06 70 31​

Answers

Answer:

D16.5 degree F. Explanation : when x = 9: y = 25.2 + 3.3(9) = 54.9 deg. when x = 5 more chirps or 14: y = 25.2 + 3.3(14) = 71.4 deg. 71.4 - 54.9 = 16.5 deg.

Explanation:

ok

The first cricket: the sky's the limit. 9 chirps in a quarter of a minute, or 15 seconds, are equivalent to 36 chirps in 60 seconds. In the same amount of time, the first cricket makes 12 chirps.

When x = 9: y = 25.2 + 3.3(9) = 54.9 deg. When x = 5 more chirps or 14: y = 25.2 + 3.3(14) = 71.4 deg. 71.4 – 54.9 = 16.5 deg.

What is the temperature affect the chirping of cricket?

As the temperature rises, it gets simpler to reach a particular activation energy, which speeds up chemical processes like the one that causes a cricket to chirp.

On the other hand, as the temperature drops, the reaction speeds slow and the chirping also decreases.

Although the amount of light has no bearing on their chirp, temperature does: warmer air causes a faster chirp.

The number of cricket chirps over a 15-second period multiplied by 37 will often give you the temperature in degrees Fahrenheit.

Therefore, The cricket is chirping because of the vibrations produced while the scraper is moved along the file.

Learn more about cricket chirping here:

https://brainly.com/question/6498405

#SPJ2

What has happened around Jakarta in recent years?



A.Large numbers of city residents have moved away to rural areas.



B.Buddhism has become the dominant religion.



C.Population growth has created a megalopolis.



D.Volcano eruptions have destroyed large sections of the city.

Answers

Answer:

letter b. Buddhism has become the dominant religion Ang sagot diyan

Answer: C Population growth has created a megalopolis.

Explanation: took the test

Oil is What is one of the primary functions of this food in the body?

Answers

Answer:

yes

Explanation:

because I it has to do with oil and fat

Could someone help me out with this easy question? I wasn’t in class today.

Answers

Answer:

B snsjididiwhejtofijsndixichhdje

what type of materials are expelled from cells during exocytosis

Answers

Answer:

During exocytosis cells expel a variety of materials including waste products, toxins and large molecules such as hormones, proteins and neurotransmitters into the extracellular environment.

Explanation:

Waste Products, Toxins, and large molecules like hormones, proteins and neurotransmitters

Identify organelles in a plant cell.

Answers

As I am not to familiar cell plant to the looks precise the leaf shape on option A. Please dear correct me if I’m incorrect!

2x2+=4tgdgdddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddfiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiccccccccccccccccccck

Answers

Answer:

4

Explanation:

cells possess defense systems, because molecules such as play a role in aging and disease in high concentrations. a.Antioxidant;Hydrogen peroxide. b.antioxidanr;catalase.
c.oxidant:potassium prrmanganate. d.oxidant;hydrogen peroxide. e.antioxidant;potassium permanganate​

Answers

Answer:

I would say C

Explanation:

Based on what I can understand it is asking about how cells age and disease. Something like that.

Oxidents result in aging and creating free radicals. Hydrogen peroxide forms in cells to break down old organelles.

3. Quantitative data uses numbers to Measure observed changes. How could this experiment be modified so that quantibtive data could be collected to show that water diffused into the dialysis bag?

CAN ANYONE PLEASE ANSWER!!​

Answers

Answer:

Mass the bag before and after its exposure to the solution. If diffusion occured, then there should be an increase in the bag's mass.

Explanation:

please mark brainlyest

To modify the experiment to collect quantitative data showing that water diffused into the dialysis bag, you could measure the change in the weight of the dialysis bag before and after the experiment.

Here's how you can do it: Prepare the dialysis bag and fill it with a known volume of a solution. For example, you could fill the bag with 100 mL of a sugar solution. Weigh the dialysis bag using a balance before placing it in the beaker with water.

Place the filled dialysis bag into a beaker of pure water. Make sure the dialysis bag is fully submerged in the water. Allow the setup to stand for a specific amount of time (e.g., 1 hour) to allow water to diffuse into the dialysis bag.

After the specified time, carefully remove the dialysis bag from the beaker of water and gently pat it dry with a paper towel to remove any excess water on the outside. Weigh the dialysis bag again using the same balance.

Calculate the change in weight of the dialysis bag by subtracting the initial weight from the final weight. The weight difference represents the amount of water that has diffused into the dialysis bag.

To learn more about  dialysis bag

brainly.com/question/30409469

#SPJ3

How is loss of biodiversity connected to extinction of organisms?

Answers

Answer:

In an ecosystem, everything is connected. All ecosystems have some form of food chain and symbiosis. This means that animals rely on each other for life. If one animal were to die then others would be negatively affected. Overall, this means that when biodiversity is lost it becomes harder for organisms to survive. For example, pandas rely on bamboo to survive. So, when it gets cut down and destroyed the pandas also suffer. Additionally, in ecosystems, a wide variety of organisms helps other living creates have more forms of survival. This shows how important biodiversity is.

Life's large molecules, or macromolecules, are classified into what four categories?​

Answers

Answer:

macromolecules: carbohydrates, lipids, proteins, and nucleic acids.

so the answer is macromolecules  

Explanation:

If the chromosome number of a typical onion root tip cell is 16 before mitosis, what is the chromosome number of each newly formed nucleus after nuclear division has taken place?

Answers

Answer:

16 in each nucleus

Explanation:

Mitosis is the process of cell replication that creates two identical daughter cells. Alternativly, meoisis produces two haploid cells (each having "half" the chromosomes) from each diploid cell.

Answer:

I don't know i need help too

Explanation:

so yea

The principle that energy cannot be created or destroyed is known as what

Answers

Answer:

Conservation of energy

Explanation:

Where do heterotrophs get phosphorus from?

Answers

Heterotrophs get phosphorus from plants and other autotrophs

Answer:

Heterotrophs get phosphorus from plants and other autotrophs.

Other Questions
Do you believe athletes need to be involved in social change? Why? Help me with this problem please please:):) Answer the following question in 3-4 complete sentences. A black and white photograph of a waterfall flowing over a cliff. The opening of the waterfall is at the very top of the photograph. The water falling takes up most of the frame. Tree tops are shown at the bottom of the frame. Who took the photograph above? Why was it taken? What was its purpose? 7th grade English Question An interjection can be set apart byAa comma.Ba number.Cparentheses.Dquotation marks. Find the volume of the cube shown at the right. h=6in When plants that are true breeding for different traits of acharacteristic are crossed, the trait observed in the first generationis called thea. dominant trait.b. recessive trait.c first-generation trait.d. second-generation trait. The height of a rocket is modeled by h(t) = -(4t-12)(4t-36). How long after reaching its maximum height does it take for the rocket to hit the ground?A. 3 secondsB. 4.5 secondsC. 7.5 secondsD. 12 seconds what is the product of the polynomials below? (8x^2-4x-8)(2x^2+3x+2) How many different 5-letter words can be madea. if the first letter must be A or Y and no letter may be repeated?b. if repeats are allowed (but the first letter is A or Y)?c. How many of the 5-letter words (starting with A or Y) with no repeats endin H? what information did the Zimmerman Telegram state that concern the United States when the telegram was intercepted what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT? FREE BRAINLIST! Help answer my question about figurative language -Write me a figurative language sentence for each picture Answer the question in the picture plz Happy Paws charges $20.00 plus $3.50 per hour to keep a dog during the day. Woof Watchers charges $10.00 plus $4.75 per hour. Complete the equation and solve it to find for how many hours the total cost of the services is equal. Use the variable h to represent the number of hours. (the)______ edificios LasLosElLa Malcolm has decided that he wants to open up his own law practice. The time has come to establish prices for his services. Due to his extensive experience and legal background, he believes that his fees should not relate directly to the time or effort spent on specific cases. Now that Malcolm has chosen the pricing strategy he wants to use, what is his next step Does this table show a proportional relationship? If so, what is the constant of proportionality? If not, explain. How did the Sepoy Rebellion disprove the claims made in Clive's letter? O Few Indian troops ever joined to serve with the BNish. O Indian troops fought against the British because they felt poorly treated. O Indian troops refused to fight a battle that would have won India for Britain. 3. Mark each of the following statements, regarding the WTO, as true or false. If false, correct the statement. a. ______ The WTO was formed by countries that conduct the majority of international trade. b. ______ The WTO seeks to increase import quotas and reduce import and export tariffs. c. ______ The WTO seeks to eliminate restrictions on the flow of money between countries. d. ______ Though it can hear accusations, the WTO cannot order remedies Approximate the correlation of the data shown below?a.0b.1c.-0.8d.-1